Description :
From Genome Similarity Track
Location :
Scaffold_10:1026692- 1028793
Transcript NameFunction/comments
Aphas_H257_04774Hypothetical protein

Sequence
2101 bases(100 bases per row)
TACACTGATGACCAACGAAGGCAGTCCTTGGTGGAGGAGCATCGTACGGGGAGGCGCTGCTCATCTGCTTCCGCGGTGGCGCGTTTTCCGCCGCCCTCGA
CACCAGGTAGTTCGTGGAGGGCGTTAGCATTCTATACGTGTTGAGTGTTGCTGCATGCCGCATTCACGCCCGACGTGAGTTCCACGGCAATCCCCATGCT
TAACGTTATGGTCGGGTACGGGTTTGTGGCGCGTTGTTCGTGGCCACCGACGTCGGCGCCGATCTCGTGGACAACATCAAGCAGGGCATCCCCGAAGACG
ACCCGCGCAACCCGGCGATGGATGTACGAACTTTGACATGGACATGACTTCAGTGAGTGTACGACAATTGAAAACAGTCGACATAGTACATCGCAAGGAT
AGACACGCAAAGAGGCTCGGAACAGGCTCTAACGAGGTGGCAAAATATTTTGATCGCGTTCGCATTTGCGACATACGCAGTCATATTTATTTATTTGGCC
AACTAAACAGCCGACCATTCCACAGCACATGCCAAACAAAATCAGCATTGCATCGTGGTGGAGCCACATGTCATCAATGGAGCTATCCATCACAATCGCC
CATATGTTGCTAAATACTAGAAGTACGATGCGGTTGTTGTGATAAAAAAAGTTGATACGGTCATGTTTGGTACAGTAATCTGGGATTTTCAATGGCTGCT
GTGTCAGCTACCCTGACGACAAGTGGTCGCCCCATTGACTCGACAACTCCATGCTGGGTTATGTTTTGTGTTGCCATACTTCTCTTTGACCAATTACTTC
GAAGTAATGAATTATCCACCCTCATACCATCTGAATGACCTGGAATGAGGTAGAATTCAGAAAACGACGTTTTGATTGGCTCCACACCTTTCCAAGTTTT
ACAGTACTTGGAACAGCAGACTCCTATGTCAGTGAGTATTTTCAATAAATGATACTAACGTTACTTCCTAGCTTTACTAACACGGCACTGCGAATTCATA
TTCTTTTTGTGAACTTATCGAACTTACAGTTAGCTGGGCAAAACGTCCACCGTGTTCAGACTCCGTCGACAGAACATCACCAGCACTACGTGGCCTCGAA
TGCCGGGCCACCATGTGACTAATACGGCGAGCTGGACCGAACCATTTAGTTTGCCATGCATCTACCGGTATAGGTCACGACAAGCCATGATAGAGTACGC
TCAGATTGTATATAGAAGCAAGCGCTGGAAATGATGTCGACAACTGATGCATAACTTCGCTCGTACAATGAACAGGATATAACTACTTATCAGCCAAGCA
TCTGCGTTTGTATGTCGAATAAAGCGAAATTATGCATAAAGTTGTCAACAGAATTTCCATCGTTTGCTTTTATATGCAATCTGAGCGTACTCTATCATGG
CTTGCCGTGACCTATAGATACATGGCAAGCTATCGGTAGTCACGTGATGGCCCGACGGTTCGTGTGCCGACGACGTCTGAACACGGTGAACAAAAAAGTG
TCCGGCTAAGTTCGATAAATTCACGAAAAGAAATATAAATTCACAGTGCCAACAAAAAAAGAGCACCTGTTCGGAGAAAAACTTTGAATGGGGTGGAGCC
AATCAAAACATCGTTTTCTGAATTCTGCCTGATTCCAGGTCATTCGTATGGTATGAAGTGGATAATTCATTGATTGGTCAAAGCGAAAGTAGGACACTCA
CTGTCAAAACATAATCCAGCATGGAGTTGTCGACTGAATGGGGCGACCACTTGTCGCCAGGGTAGCTGATGCAGCCGCCATCGACTACCACTGATTACCA
AACATGACCGCATCAACTTTCTCTATCACCAACAACCGCGTCATACTTCTAGTATTTAGCAACATATGAACAATTGTGACGGATAGCTCCATTGGTGACG
TGTGGCTCCACCACGATGATATGCTGATTTCGTGTGGCATGTGCTGTGGAATGGTTGGCTGGTTCGTTGGCCAAATAAATAATTACGATTGCGTATGTCG
CAAATGGGCACGCAATCAAAATATTTTGCCACCTCGTTAGAGCCTGCTCCGAGCCTGTTTGCGTCCGCAAGACTCCTCGACCAAGGCCTCAAGTCTGGGA
C