Description :
From Genome Similarity Track
Location :
contig_109:102669- 104201
Transcript NameFunction/comments
g11189.t1actin-like protein

Sequence
1532 bases(100 bases per row)
AAGAGAATCCTCTCGGTCCTCAGCTCGTTCCTGGCAGTGGCGTCGTTCAAGCCCACGGTGGTGATCGACAATGGCACGGGGTACGTTCCCTGCATCCCCC
TTCCCTCCTCTTTCTGTCAAAGTTGCAGTATAATCCATTCCGCACTCGCGTGTCAACAAACAATTATTGCTTTTGATCTGTCAACCATTATTCTCGACAA
GGTACACCAAGATGGGGTACGCCGGCAACGCTGAGCCGAGTTACATCATCCCGTCCACGATTGCCGTGGGCGGCAGCGACTCGAGCACCGTGCGCAGTCG
CCAGGGCATCGACGACTTGGACTTTTACATCGGCAAGGACGCGCTGGCCCACGCGTCCACGCACCAGGTGCACTACCCCATCGCGCAGGGCATCATCCAG
AACTGGGACAACATGGAGAAGCTCTGGCAGCGCTCTCTTCCAGCACATGCGCTGCGAGCCAGAGGAGCACTACATGCTGCTCACGGAGCCTCCGCTCAAC
CCGCCCGAGAACCGCGAGGCCACGGCCGAGATCATGTTCGAGACCTTCAACGTGCCCGGTCTGTACATCGCTGTGCAGGCCGTGCTGGCGCTGTATGCAT
CATGGCCCAAGATCAAGGACCCAAGCCAGCGCACGCTCACGGGTACGGTCATTGACTCGGGCGACGGCGTAACCCACGTCATCCCGTCTCGGACGGGTAC
GTCATTGGCAGCTGCATCCGCCATATCCCGTTGGCGGGACGTGACGTAACCCACTTTATCCAGAGGATGCTGCGCGACCGAGGAGAGGCCGTACCCCCGA
GGAGTCGCTCGACGTGGCCAAGCGCGTCAAGGAGAATGCACAGCTATGTGTGCTCGGACCTCGTCAAGGAGTTTAAAAAGTACGACGCTAAGCCGGACAA
GTACTTCCTCAAGTACTCGGACCTGCACTCGCGCACCAAGCAGCCGTGGGAGATCGACGTGGGCTACGAACGCTTCCTGGCGCCCGAGATTTTCTTCAAC
CCGGAGATTTTCTCGACGGACTTCACGACGCCCCTGCCGAATGTCGTGGATGAAGCCATCTTGAAGTGCCCCATTGATACCCGCCGCGGGCTATACAGAA
CATTGTGCTGTCGGGAGGAAGCACCATGTTCAAGATTTGGACGGCGTCTGCAGCGTGATATCAAGCGCCTCGCGGACGACCGACAGGCAGCCAACCTGGC
CAGACACTCGACGTTCCAGCAGGCCCACGCTGAGGCCCTCGAGGTGAACGTGCTGTCGCACCGCATGCAGCGTTTCGCGGTCTGGTTCGGCGGCAGTATG
GTTGCAGCCACTCCCGAGTTTTACCGTGTTTGCCACACGAAGGCCCAGTACGATGAGGAAGGCCCGCGCATCGCGCGCCACAACCCGGTGTTCAACACCA
CCATGTAAGCGCAGCATCTACTGATCAACGGCTCAGCAGAAGCAACGCGCGCGACAAGGAAGCAGGCGCGTTCGTCGTCCTGTACGAGTGAATACACGGA
GGACGTAGACGAGTAACGTGAGAAACCCAGCA