Description :
From Genome Similarity Track
Location :
Scaffold_10:1026687- 1028801
Transcript NameFunction/comments
Aphas_H257_04774Hypothetical protein

Sequence
2114 bases(100 bases per row)
CAATGTACACTGATGACCAACGAAGGCAGTCCTTGGTGGAGGAGCATCGTACGGGGAGGCGCTGCTCATCTGCTTCCGCGGTGGCGCGTTTTCCGCCGCC
CTCGACACCAGGTAGTTCGTGGAGGGCGTTAGCATTCTATACGTGTTGAGTGTTGCTGCATGCCGCATTCACGCCCGACGTGAGTTCCACGGCAATCCCC
ATGCTTAACGTTATGGTCGGGTACGGGTTTGTGGCGCGTTGTTCGTGGCCACCGACGTCGGCGCCGATCTCGTGGACAACATCAAGCAGGGCATCCCCGA
AGACGACCCGCGCAACCCGGCGATGGATGTACGAACTTTGACATGGACATGACTTCAGTGAGTGTACGACAATTGAAAACAGTCGACATAGTACATCGCA
AGGATAGACACGCAAAGAGGCTCGGAACAGGCTCTAACGAGGTGGCAAAATATTTTGATCGCGTTCGCATTTGCGACATACGCAGTCATATTTATTTATT
TGGCCAACTAAACAGCCGACCATTCCACAGCACATGCCAAACAAAATCAGCATTGCATCGTGGTGGAGCCACATGTCATCAATGGAGCTATCCATCACAA
TCGCCCATATGTTGCTAAATACTAGAAGTACGATGCGGTTGTTGTGATAAAAAAAGTTGATACGGTCATGTTTGGTACAGTAATCTGGGATTTTCAATGG
CTGCTGTGTCAGCTACCCTGACGACAAGTGGTCGCCCCATTGACTCGACAACTCCATGCTGGGTTATGTTTTGTGTTGCCATACTTCTCTTTGACCAATT
ACTTCGAAGTAATGAATTATCCACCCTCATACCATCTGAATGACCTGGAATGAGGTAGAATTCAGAAAACGACGTTTTGATTGGCTCCACACCTTTCCAA
GTTTTACAGTACTTGGAACAGCAGACTCCTATGTCAGTGAGTATTTTCAATAAATGATACTAACGTTACTTCCTAGCTTTACTAACACGGCACTGCGAAT
TCATATTCTTTTTGTGAACTTATCGAACTTACAGTTAGCTGGGCAAAACGTCCACCGTGTTCAGACTCCGTCGACAGAACATCACCAGCACTACGTGGCC
TCGAATGCCGGGCCACCATGTGACTAATACGGCGAGCTGGACCGAACCATTTAGTTTGCCATGCATCTACCGGTATAGGTCACGACAAGCCATGATAGAG
TACGCTCAGATTGTATATAGAAGCAAGCGCTGGAAATGATGTCGACAACTGATGCATAACTTCGCTCGTACAATGAACAGGATATAACTACTTATCAGCC
AAGCATCTGCGTTTGTATGTCGAATAAAGCGAAATTATGCATAAAGTTGTCAACAGAATTTCCATCGTTTGCTTTTATATGCAATCTGAGCGTACTCTAT
CATGGCTTGCCGTGACCTATAGATACATGGCAAGCTATCGGTAGTCACGTGATGGCCCGACGGTTCGTGTGCCGACGACGTCTGAACACGGTGAACAAAA
AAGTGTCCGGCTAAGTTCGATAAATTCACGAAAAGAAATATAAATTCACAGTGCCAACAAAAAAAGAGCACCTGTTCGGAGAAAAACTTTGAATGGGGTG
GAGCCAATCAAAACATCGTTTTCTGAATTCTGCCTGATTCCAGGTCATTCGTATGGTATGAAGTGGATAATTCATTGATTGGTCAAAGCGAAAGTAGGAC
ACTCACTGTCAAAACATAATCCAGCATGGAGTTGTCGACTGAATGGGGCGACCACTTGTCGCCAGGGTAGCTGATGCAGCCGCCATCGACTACCACTGAT
TACCAAACATGACCGCATCAACTTTCTCTATCACCAACAACCGCGTCATACTTCTAGTATTTAGCAACATATGAACAATTGTGACGGATAGCTCCATTGG
TGACGTGTGGCTCCACCACGATGATATGCTGATTTCGTGTGGCATGTGCTGTGGAATGGTTGGCTGGTTCGTTGGCCAAATAAATAATTACGATTGCGTA
TGTCGCAAATGGGCACGCAATCAAAATATTTTGCCACCTCGTTAGAGCCTGCTCCGAGCCTGTTTGCGTCCGCAAGACTCCTCGACCAAGGCCTCAAGTC
TGGGACACCCCTTT