Description :
From Genome Similarity Track
Location :
Scaffold_356:10265- 12399
Sequence
2134 bases(100 bases per row)
CGATTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGT
TGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGAGTTCCTTTTGAGTATTCAGCAGCGCTAGCAAAGTATCCTTCCTGCAAGC
GATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGCGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATAGCGGCCTTGACACCGTTAATCATC
CCTGTATACTCTGCCACATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAACCACTATCTTCCACTCAGGAAGACTCCACAGCACCCATGAACAAC
TCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCACTGTAATTACGGTAAAGCTTGGCGTACAGCAACGCGGGGTC
TATTCGAATAGTCGGGAAACCCTTGTGTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCG
AAAGCTACATCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACAGGACCGCGCGTCCGAAGAGAGACTTCGACTTAT
GCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTC
CTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACTCGGCCGAGGAACCGTCCGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTG
CTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGCCTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAACTTTT
CGAAGGAACGACGTGCCACAGAAAGGCTACCTTCAACGGCAAAGTCTTCATCCTTGAGCTGGTACAGTGCCGCACCGTAGACCGCGAAGTCTTGAATGAA
GCGGCTGTAGTAATTAATCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTTGTCGGAAACGAAAGCTCGGTGATAGCCGCAAGCTTCTTGGGGTCAGCT
TTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGAAGCTCTATGTGAAGCTAATGCTGATCCGACACTGTGCAAATC
TTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGACCGTCGACCAAACACAGGTGCCAG
TGATGATTCGTCCGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCC
GCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATTCAAACCAGCCTC
CTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCGAAGGGCATGCGTAACTACTCGAAATG
TCCGAGTGCGCAGACAAACGCCGATACTTTCCGCGCTTGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAGCCATAGGTAA
CGCTCGAGATCGGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGGTAGCATTCACCATCTTGAAATCAATACATAGCCGGATGT
CCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTTCTGCACGCAATAAAGCGCGCAGCAGCTCGTA
CAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCAATATCGCATACCGCGCCGTAGGCTGGCGGC
GGCAGTGCGTTACCACTAGCAATCAGGATGTGCT