Description :
From Genome Similarity Track
Location :
Scaffold_845:10264- 13682
Transcript NameFunction/comments
g8947.t1ETP25916.1 hypothetical protein F441_01272 [Phytophthora parasitica CJ01A1
g8948.t1hypothetical protein

Sequence
3418 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACC
CCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCGTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGACCTTA
AGTATACTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCACTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGACTAAGAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTC
TGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCA
ACGATGTTGCGAACGCAATCGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGC
CATCGGCCACACCGCGCGTGGAGTCATTAAAACTCCACGTAAGCAACTACGTTGGAAGAGAGGGAGAGTCTCTCCTCCGTTGGCTTGTCGAGGTCGACAC
TGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATTTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGA
CTCACAGACCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAG
TTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGA
CAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGC
AATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCA
ATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCG
AGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAAACTAAAGGGACCAGCAGGGCGCGGGGC
GCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATTTCACTGCAAGAAGCAAGATGA
CAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAG
AGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCG
TACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCT
TGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCA
CATGCACCGCGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTG
GGAGAAGATGTAAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGA
CACACAATTTGTCGAAGGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAA
CGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAG
AACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCG
AGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTACCGGGCAGACACAGGAGTTGGAGACAACCGTCGAGACACTGAGCGTC
TTGACGCGTACAAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGA
AGCGTTTCGCTCGCGAACTGCATCCTTTCGGACGTCGAGAGAGTGACGTGTGAAACAGAAGAGCTGAGGCAGCTCATCTCTGAGGGCGCGGACGCCCTCA
GCGCGAAGTCGAAGAAAGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCC
GGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTTAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATCTGTCAAGTCGATCGACGACTTCT
TTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGT
TCATGCGTACAACAAGCTGAACGATGCGACGGTATCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTC
AGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGT
GGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTT
CGACGACGTGTTCATTCA