Description :
From Genome Similarity Track
Location :
Scaffold_82:102638- 103649
Transcript NameFunction/comments
g7162.t1RAW29671.1 hypothetical protein PC110_g13966 [Phytophthora cactorum

Sequence
1011 bases(100 bases per row)
TCCAGCGTGTCGATGTGGTGGACCTGGGCGTAGTGCAGCAAACCGTTTCCACAGTCGCCGCTGGTCTTCCACACGTACGCGTAGGCGTCTTCATTGTGGG
CTTCAACACGGCCACCGTCGAGGACGCAGCCCGCCGTCTGGTCGAAGACGTTCTGCTCTTGCGCAGAGGCATCGGGGATCAGCGCAACACGAGCAATGCC
AGTGAATGGGCGCTCCATGTCGAGCACAGAGTGGCCATCAAAGTGCAGCGCGACCGGAGAAGAGAAGTACAGCGTCCAGGTTGCGCCGTTGTCGAACTGC
AGCACGAAGCGGCTGTTGGTAAGAGGAAGGCTGACGGTCTCCGTGGCGTCCAGGCCGTTGATGGTCGAGATGTTGTACGCCGTCTGGAACCGCGGCGTCA
GCTCAGTGTATCGAGCAGTGACGAAGGCCATGCCGCTTGCGAGAGTCACCTCGATCTTCTTCGCATCATCTTCACGGGACATGAAGCGGAGCTGCACGCT
CAGATCGTCCCAGTCGAACACCTCGAAGCTCGGGTGCGAGGAGTCGGAGAACTCGGTGGCGGAGAAGGTAAACTCGGGCACTTGGCCGTGCAGGTAGTAC
ATCTCGGCATCGCCGTTTCCGGTCAGGCCGCCTCCGAATTCACGCGTCGTGTACGGGTAGTTCATGGTCAGGCCGTAGGGCTCCATGGCGATGCAAGGGG
TCACGCTGTACGGGTTGGTCCACACGGGTTGGATGACGTCGGTTTTCTCGCCGACCGTGGCGCCGATCAGGTTGCCCCACCAGTCATTGGTCGGGATAGG
ACGCGAGCCCACGAGGCCGGGGGCCAGGAACTTGGGCGGCAAGAGCGTCTTGTGCGCGTCGGTGTGGTTGAAGAGGTTCTGGGGCGGGGCTTCGGCGTTG
AAGATGGGCGTGAACAAGTCGAACTTGGCGTCGGGCGCCACTGTAGTCACGCTCCGCAGCGTGGACGCGCCGGGGTGGAAGATGCCGAAGACTGCGGCGG
CGACGAGCAGC