Description :
From Genome Similarity Track
Location :
Scaffold_39:102620- 106723
Transcript NameFunction/comments
Physo_135544reverse transcriptase

Sequence
4103 bases(100 bases per row)
CCCACGTGGGCTCGTCTTGATCTGCCCACTTGATCTTGAATTCACGCACTGAGCGTCCCGTTCTTGTTGACATGGGCATCCGATCATCCAGAATTTCCAA
CACTTCGCTCTCACCGGCCAGACTATCAGGTTCCCAGCTGTCTTCGGGGAGTAATCCTCGTCGAAGTCCAGCCGTGAGTCTTCGGTGATGTCAGGCGCCA
ATCGAGCCTTCGGGCGGTCTTTGAATTCACTCACCGGCTTCAACCGCGAGACATGGACTACCGGGTAAAACCGATAGCCGCTCCGGTTCGGCAACTCGAG
CTCGTAGGCGTACTCTTCGACCTTCTTCTTGATCCGGAACGGGCCGTGCCAGCGGTGGGCCAGCTTCTTGGTCAGCCCCGGCTTGACACGTTCCATATAC
AGCCATACGCGACTACCCGGCTCGAATAGAGACATCGGCGCGTTGCTTGAGGGGTCTGAGTCCGCGTCCTGATTGGTTGGCGTTGCTGTCGACCACTTGT
TCCTGCCAGTCGTCGGGATGGTTGCTCTCTCCTTCCGGCTCAGTGCTTCGTTATGTTCGCGGGCTCGGCGGGCTTTTTCAGTCGCTTGGTATTCCTTGGT
CATATCGAGTGCAATCTGGTGTTGTCGGTTGACGTCCCGGCGCCACGCCAGCGCGTCGGGTTGTCTGCTACTGCCCCTGCGGAGCGAGGACGACATCGCT
TTCAACGTCGACTGAGCGTCCCATCCATGGACGAGGAAGAATGGAGTTTCCTTCCGTGTCATGTCTTGTGAGTTGTTGATCGCGAAGACCAACCGTTCCA
CGATCTCGTCCCAATCCTGCTGAAGCGGGTCTTCGGCGTACACTCTCACGGATTGAATCACCGTCTTTACCGACCTCTCTTGCTGCCCGTTGGCTTGGGG
CCGATAACTCAGCGTAGCCCGCGACCTTGACTGCATCATTTCGGCAAAGGCCTGGAACACCTCGCTCATAAAGCGAGGATCCCGGTCGTGTCTAACCAAC
GAAGGTGCTCCGAATCGTCGGTATATACACTCTTCGAAAGCTTGGGCTACCTTGAGCGCTGTCGTGTCCGACATTGCCTTGGCGATCACAAATCCCGTGA
ACGCATATTGGAACAGGAGGAGGGCAGTGTTGCCTCTCCGAGTCATCGGGAGCGGTATTTCGAAGTCCATGGACACAATCTGGAGTGGTCGCCCTGCCAA
CACGTTACCGGGAGAATACCCTCGCAACTGTGGTCGGCGTTTGCTGGTGCTGCAGTCCGGGCACGACTTCACATGCTTCTCGACGTCTGTGTAGAGGCCG
AACCAATAGTATCCCGCTTGACTCGCTGGTAGGTCCGCACTACCCCTTGGTGCCCGCCTTCTAGCGAGTCATGGCAGTTCTGCAACACTTCTTGAATCAT
CGTGGTGGGTACCACGAGACGCAGCTTGATCTCCTCTTGCTCTCCAGACGTGTCTGGACGACTCGAATTCACATTGTAGAGTACTCCGTCGTCGGACAGA
ACGAACTTGTCCGCAATTTTCCAGGCATCTCGTGCAGCCCTGTACCCGAGCTTCTCGACCTCGCCTCGGAGGACTGTTTTCAGGTTTCCCCACCGTAGTT
CCTCGTCCTGAGCGGCTACTATGCGCCGTCGCCTCTCCGCTTGGACTTCGACGGGGTCAATGTCTTCTGCGTTTGGCGCTGCAGGCGGTGCTTGAGCTGC
TTTCGGTGGTCGTTCATCAGTGTGCTCTTTGTCGGTTTGAGGCATCGGCTTGGGTGGCGTCTCGTTCGTACTGTCGTCCGCAAATCGGATTCGCTTCGTC
TTCGATCTAGCCTGTGAACGAGTCATCGCCATGATCCTGAAAGGTTCTTTGCGCACGAAATCAGCGAATGTCCTGGGTTTGGTGACCTCGTATCCGTCCG
CAATTTGAATAGAGCCTCCAGGAACATCGTTTTGCACTGATGCTTCATCTGGCGTCGACTCATAGATCACTTCCTGGATGCGGTTCAGTTCGCAGAGCTC
TGCCTTCCGAGTTTCACTCAGGACCACCTTCGACGTCTTAGATTCAAGTGTTTCCGACACCAATGAGTCTGCGGCTGCATTGAATTCTCGAACCACGTGC
AGGTACTTGACTGACCGCAGTCGTGCCGTGATTTCCTTGTGGCGACTCAGCTGAGTCATCAGCGACTCCTTCCGGCATGCGATCACCCCTAGGGATTGCT
GGATCGCGAGCCTCGAGTCCCCGACGATGACCAAGTCTTCGGCGCCATGGTCCAAAGCTGCAAGCACTCCGTTGGTCATGCCAGTGTACTCGGCGTGATT
AACAGTCGTCTTCTCGAGGTAAGCGCTCGCCGCAATCAGTATTGTCCATTCTGGTAGGCGCCACACGATCCACGAACAACTGCCATATCCACCATACTTC
TCGGTCTTCGCGGAGCCGTCAAAGGAGACCACAAACCCCGTGTGAGTCTTCGGGAGACGTGCGTACAGGAGGTTTGGGTCCATACGAGTCGTCGGCGGGC
CTTTCGTCGGTGGAGCAACCAGGTCCAGCGAGTCATCGAGGTCCACAAAGTTGGTTACCGTCGACTGGGGCAGTTGTGAAAATACGCAGTCCTTCTCCTT
CACGCGCTGGACGATCAAGTGCCACGGGGAAAGCAACACGGCGAATTGCACCGCTCTCCCGAAGAGTGACTTGGACTTGGTGATCCATTCCAACGTAGAG
AACCGCGTGTACACGCGGATGGTCCGTCCCGCTAGCTGCGTATAACAGGTCTTCAGGAGCTGGAGTAGAGCAAACACCTCCATTTCTGCAGGATGGTAAT
TCAATTCTGCGTTCTTCAAGACGCGACCACAGAAGCGCACGGGGAGCAGTTTGTCGTCGTGCATCTGGAGCTATGTCGAGCTGAGTGCCCATTCGTTCGC
GTAAAGCATCACGTGCACGTCCTTCTTCTTATCGAAGTGCCGAAGGATCGGCGCCGCCGCCACCTTCTGCTGAAGTGCTTGGAAGCTGCGGCGGGCTACA
GCGAGGCCACCCCCGGGCGCGAAGTCGTCGTCCTCGAGCTGGTACAGCGCGGCTCCATAGACTGCGAAGTCTTGGATAAACCGCCTGTAGTAATTCAGCG
CTCCGAGGAAGGACTGCATCCCCTTTTTTGTCCGAGGGAACGACAGCTTCGTGATTGCGTCCAGTTTCTTGGGGTCTGCGCGCATCACATCTAGCGAGAT
CTCGTGCGACAGGAAATCGACGCGTCCTTGCACGAATATGCTCTTGGTGAACCTGACGCTGATCCGGCGCTCCTCAAATCGGCTCAAGAGCCGGTCCAGC
GTGGCAAGACAGTCTTCGAAGCTCTCGCCTCCGAAGCATATGTCATCCACAAATGATCGGCGATCAAACACCGGAACCAGTGACGAGTCGTCGGGCTCGT
TGGTCGCAAACATGTCCGCATTCGGGCTGTTGATCAGCAGCAAGACAGGATCTAGTCATCGTGGGCGGCTGCAAACTTCGTGCGGGACGCTGCGGAAGGG
TTCTGCAGGTATCCCGACGACTCGAGTCGTCGGATACGTGCTGATTCGGCTTCGGCAGCTCCCATCCGTTCCGCAAAGGCCTTCCAACCTCCCTTCGGCT
GGACATGACCCCACAACGCGTTGTCGATCATGCGCTGGTAGATCATCGGCGCGTTCTTGAGGACGAAAGGCATGCGAAGCCACTCGAAATGTCCCAGCGG
GCAGACGAAGGCCGAGATCTAGCGCGCTCGTAGCGTCATCATGATGGCCCAGAATCCACTCGCAGCGTCGAGTGAGCAGAACCAGAGGTATGCTTCTGGT
CGGTCAACAAGTCATTGACGAGTGGCATGACGTATTCCATGATTGCTGTGATGGCATTGACCAGCTTGTAGTCGATGCACAGTCGAATGTCGATCCCGTT
CTTTTTCAGGACGATGACGATCGGCGATGCCCACGGGCTGTCAGAGAAAGACACGAGTCCAGCCTTGAGCAGCCCCCTCAGCAGCTCATACAGCTTCTTG
AGATGCGGGGCTCGTTGCTTGATCGGCGCGTGCCCTTGCACGTCTATGTCACAGACCACCCCATATGCTGGTGGTGGTAACGCATTACCGCTTGCGATCA
TAA