Description :
From Genome Similarity Track
Location :
contig_75:10262- 11622
Transcript NameFunction/comments
g9993.t1hypothetical protein

Sequence
1360 bases(100 bases per row)
AGATGAGCCTCATCGACCTGGCGCCCGCAAACACGAAGCGTGCCCGGGAAAACGCATCGCGCACCTTTCTCAAGTTCCTGGCAGACGAGGAGGTTGCCCG
GGACAACCTAGAGACGTGCATGAAGCGCGACAACGCTGCACAAGTGCTGGCAGTGGTGGACAAGTTGGCACTATCTTGCTTTCAAGGAGGGCCGCAAGGG
CCAGCTACTCGCTCGTCACTCCGTTATGCAGTACTTCAGGCAAGCCAAGAACAGGCTGTTGGAACAGTCCCTCAGCATCGAGCCTTGGTTGACAAGAACC
TGCTCAAGAAGGGCCTGATGCTGGAGCGTCATTGTGTGAAGCGCGAGACGGGGGCGTTTGTGAAGAAGGCTCCGGCATGCACGAAGACGGCGCTCAAGAA
AATGATGGAGTACCTGTATTCGACGGCGGTTACTGCTGCTGACTCCAAGACGCGGCGGTGGCGGCGTTGATGTGATTCCTATTCGGGCGCGCATCGGATC
TTACCATGCTTCGAAAGGCAAACGTGTCCGTTGGCTCGGACAAGATCTTCTTCGCCCGCTTCATCCGCATCAAGACATCGGAAGAGCAAGGTCTGTCGCT
CTTTCCCGACGATGACTTCACCACGTGTCCGCTGCTCGCCATAGCGGTTGCTCTTGCGACTCAGACAGCCGACCATTTCCGTGTTGAGCCAGCTTCCTGA
GCAGACGAAAGTTTCCCAAGCTTCTCTGTCTCCATCCATTCCACTCATCGACCTTCTGGATCACCCACAAGCCGTTACTCCTCCCCAAGATTCGGCTGGC
GAAGCTGGCATGGTACGAGTACTGATGCCGCGCCTGGTGTGCACAGATACGTCAACCGCGTCCTTGATCGGATTGCAGAGAAGGCAGGTGTCGTCGAGCA
ATTGACATCGCATTCCTTCCGCCGTGGAGGGGCGCAGCACGCGAACGGAGCCGGCTTGCGTGCCCAGTGGAGGCGCTTGGAACATGACGGCGACGAACAA
GGCATTCGCGTACGTCTTCAATACACCGGCCGAAGATCACCAGGTGGCTCGCGTCTTGAGTGGTCGCGACCCGGACCAAGAACTTCACGTCTCTCGCTCG
ATGTCTTTGACTCAGCTACGTAGACGAAAATCCACATGATAGCGGTGGCTCTCTTCAACGCGTCCTACGGGCTCATGGCATCACAGTACAACGTGAACGG
TATTGTACTCGACACGTTCATGGTTTACCTGCTGCGCCACTATCCCTCGTTGAAGAAGCTCAATGAGAACGGCCTTCCTGTGGAGCGCCTGGAAGCATGT
ACGATCCAGCAAGGCCATTCCGTCAACGAGCTCCTAGCTTGGTCATCACACCTGACCTGC