Description :
From Genome Similarity Track
Location :
Scaffold_453:10261- 13191
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_453-snap-gene-0.14P-type ATPase (P-ATPase) Superfamily

Sequence
2930 bases(100 bases per row)
AGATGACTCGGTTCTTGACTTCAACATGGCTACATTCCACGGGGGTGACGTGAGCGACGTGCGTGTACTAGAGCAGCACCAGAGAGCATGCATGTCCCCA
GCGTGACGTCGCGCTCTGTGCTTCCGCATGGTGGATCAGGAAAAACGCGACACATTTCAGAGGGAACCGAGACAGCGGGAGAGGGAGAATCTCGGCATCG
TATGGAGAGACTGGCGTAACAACTGGAGGTCATCAAGCGCTTCACGTTCCTGTGCTCTACAGAAATTTTTGTGGGGCTGCATAATGCACCCATCTGGGCG
TCAGCGATATGTGCACACAGCTGCAGAGACGGCGCACCCACTATGGCTTCATCTGGTCTCGCCGACACTGCAAGTCTTTGGCTTCGAAACCGCGTTGGCA
ATGCCGATCCTCATCCTCTCTGCACCGCCATGTGCTGATCTCGCCTTGTCTCTCCCCCTGTATATCGTTTCCCTCACCTTCACCTTCGACATCGTTCCTG
ACCACCTCTTCGTGCTTCTCCCGCCActATGgcGGCGCTTCGTcGGCACGTAGCGTATTATCACTTCTCAACTTGCCTTCTCTCCAaCAAGAGCCAACCA
CcAAaGCAAACTTCTACTAGCCAAcATGGGATGCATGCAGTCGACCCCAGTGAACGAGCCTGTCGTGGCCGCTCCAGCTTCAAaCAAGTCGGTTGCCGAT
GCTCCTGTCAGCCAGGCAAGCGCcGCCCCTGCCCCAGTGTCTTCCAGTGCTGTTGAGCCTGAGGTCGAGGCTGCGCCAGCTTCTCAAGGCACCAAGTAtG
TCGTCAGCGGTGTgTCTATCACGGACCaGGGCGTCGTGTTCTACCaGATCGACTCGGCTGATGGTTCGCTCACGATCAAGCGTCGCTACAACGATTTCAA
GGCGCTTTACGCTCAACTCaGCGACGTGTCAGCGCTCCCTGCACTTCCGGAAGCcGGCTTGAAGACACGCTTtGGTGCTCGTCACAGCCAGGAGCTGCTA
AAGGCACGAGAgaCGCAGTTtGCCAAGATCCTCAACGCCATTGCCAACACGCCAGCGgTTGCTGAGTCGGGAGCATTCCAGAAGTTCATCTCGGCCTAGG
CGATaTACACTACCAGCGCGTCAGACGTGTAATTTagAACTTGCATAACGAATCTACCTCCCTCACCTTTCTTCAACCATGGTCATCAACTCATGCACGC
CTCAGGGCAACGGGATTTGATCCTCTaTGTGGGATCCCGTCCGGAGTCTACTTACTGtGATGATACTGCTGCTACAACGTACTacGTAGTACTTCAGAAT
TCTCCGCGTAGTTCTTCGCGtCGACCACGTGCACTTACGCTATCCCTTGAATCTTCGTTCAGAaGAAGTGAGGGAACACGATGTGAATGCGTTAATCCAA
ACTCATAGTATTTGATACATGAGCTTGGCCATTTATTCCGAAAGTTCTTTTTGCTTGAGCTGAAGCAAAGGATCATGCCACACTAGTTAACCTTACTCTA
TTGATTCGCTATTAGTCCCTTCATGCAGTAGTACTCACAGGTCTTGCTGGGCGTCAGTCCTCTCACTCATAGCAGCTTCCTGACGTTCTCGTTGCATCTC
CTGATACTTCTCCGAGAGTACCCACTGTCGTCGTCGCACGAAGCCACGCATCGGCCCAATATTCTTCTTGCTTGATGGACGCGGTTTCTGTGGCTTGTCG
GCTGCACTCTGCTCAATCTGCTCATCCTCTGGCTTCTCTGGCGGGAATGACGGGAAGAATTTGAAGTCAACCTCGTACACCCAACCTTCGTCATCACAGC
CAGGGACATCCATGTTGAGCTCAAGCCCAGCTAGAGGAATGGACATAGCGCTGATTTTGCCGGATCGGTCACTCCAACGgCTTCGgTCGGTTGGCAGCAG
aTAGCCTGGgTAAGTACTTCCATAGCCGCAGAACGGCTGGTAtCGTTCATtCTCGAAAaTGACTGGATCATCCGAGTTCAAGATGAAGTTGCGCACATCG
GGGTTCATGCTCTTTCTTCGGAGTGGTCCAGAGTTTGATCGGCCACTGCCACTGCTGTTGGACAAGATCCAGTTCACGATGTAcGCTGGCTGCTCGAATG
CAAATCCGCGGTAAAGGTTGGTGCGACCAGGGGCGTGGAATCGCACAGGTGCTCGCTCCTGAGTGCGACGCTCTCGATAATCGATCATGTTTTCAAGCTC
GGGGCGCATGTACGAGACCATAGGAGGAGAGTACTTCTTGAGGTCGTCACCTGCTTCGATGTCacGACCACCGTTCACCAGGTACAGTTTTTCCTTCACA
AGGTCGATATAGTCAGGGTCGAAgCGGCGACGGTATCCTTCGTACAAAAAATCCTTGATGAAAATGGCGATCGCAGCGAGCAATGGACCAAGCCAGAACT
GTGCCCGCCCGAAAATCCATGGGAACGAGTAAGTGTCGTAGTCCGGGTTGGTCCAAGTAATCTGATCGACGACATACTGGAAGAAATAGAGCGCCCACAA
CGAGATTAGAATGCCCGtcACCTCGAAAACGTCCCACGAGTTCACCATGAGACAGAATCGAACTGTAACAACGACGCATAACACGGTCCATCCCATGCTT
TGGAGTACTGTAAaCTCGACTGAAACGCCGTCGCGCATCACACTTTCAGCTGCAGCCAGAGTGAAGTAGTAAACACCGACCGAGTCAATGATCGCCATGA
CGATCCACTTCCAGAACATTGAGTACGTGAACATCGTTCGCTGGCGAGTACGTGGGTGGTAGAGCGTTGGGTAATCCATGGCAACTTCTTTTGGTAGATC
CCGATCAAGAACGGCGTAAACAATAATCGGAAGCGCTGTaaataaaaGATTGTACCCTTGTTGAATGAAAGCGGAGTAGATCATCGTTCCCGAGTACGCC
GACGGCCACAAGCAGTACCAGAACATCGAC