Description :
From Genome Similarity Track
Location :
contig_78:10259- 12118
Transcript NameFunction/comments
g11979.t1hypothetical protein

Sequence
1859 bases(100 bases per row)
GTCCAATCCCTCACACTCATCCATCAATGTGGCGAAGGTCCGCCTCGAGATGTTAATCAACGAGCGTCAGGTACCAGCACTTCTCCCGTTGCTCAACAGC
TAGAACGCACATCTCGAGAGATACATTTTTTGTTGCAACAGGTTTTGTGTCCAAGATGAAAGCACGGATAGCTTCAACGGTCCGAAAAGATGGACGTGCT
TCTTCCTCCTTTTGCGCCGCTCGCTCTGCTCAAATCAACTCCAACGTCGTTGGCATCAGCAGCCTCTGATTTGTTGTTTATCGCACTAAACCCAGCCATA
CATTACCTCCTAAGACACATCGACCTGCACAGGGAATAATTCGATTCAATAATGAAACTAAGTTATAATGAACATCATCGAAATAGTTCGTGCATGGTAC
AACACATAGGAGATGCTGGCACTTGCCTTCCAACGGCAATGTGGATGTGCGGTGTGCAGTATGGCATTCGAATGAGCTCCTCGGTCGAATGGTGTAAGCC
TCAACCCCATGAGTAGCGTCACGGTCAGCATCTCTGCAGTAGCGGCATCCTCCCATGAAGAGAGGGAGAGGGGGGATGGCGACGCTTCTGGCGACGCCTC
ACAGGGTCATTTCTAATGTCCACTACGCATGTATGTGTGCTGCACACCCACTCATGCGGCACACCCAAATGTCAGCTTTTTATATGTATGATTGGCTCTT
CCCGCCAGAAATGACCTGCTGAGGTAGCCCCACTGGATACTTAAGCGGTTCCGTGGTTGCTCACTTAAGTTGATTTCTATGCGCTCGCTCAATCGCGACT
GTTAACTTCAGTAACACAAATCATCGTTGTACTGTGGTTTGTCGTTCAGGTTGTCAAAAGTTAGGGCTAAATAAACGAGTATAGAAATATGTGAATTCCA
TTGAAGTTGGCATTTAGATACTCTGTCCCGTGCGGGATTGGGACTATAGTGAAGGCAAGATAGTCGAAGTTTAAGACAGCTCCAAAATGTTTAGAATTTC
AAGAAATTGAAGCCTGGTTGAAGTTTCTATCCCCGGGCTTCGTTATGCTCTCAGCCTTAAGCTGAGAGAATAAGTCACTACTATACACTATTAGTATACA
GACACAGCGTTGGCGCTTGCAAGGAGACCGAAGATTGATACGATTAGGAGATGCAGACGCATTGGGAAGCTTGGGCACAGAAACGCAAATTAAGGAATGC
GCTTGCAATCCAAATGAAAGACGGTGAACCTGACAGCCTGTCCACAATCTGGACAGGCATTGGAGCGATTCCCGCAGCCATTTGAACTGGTTCAGATCCA
AAATTTGCCCTACCCCATACATAAAAAACATTATAATCTTCAAGTGTTCAAAGGCAGTGGTTCAGACTTAAAATCTGGGCTTTGGAGGATAAAATGACCT
CAATTAAGCGCTCTACCTGTCAATCTTGATGACTTCAACTAACAAGCCACACTCTTTTTCCACATCAAGGTCTGGCCCTCATCAAGCTCAAAACTCCAGA
CTGCCCACCACGAACGCGGAGGTGGACACAGAGGCCGGGCGACAGCAGCGGAGCGAGCAGGAGCTGGGAATATCACAACTTGGAGGCGAGTAGACGAACC
TATTCAAGCCTTTGAGCTGTTATCACCAACCATAAGCATCATGGCAAGGAGCGGGAGGGTTGCAGGTGTCGAGAATTACAGCTCCCAGGATGTGGACGTC
CTCCTGGAGTTCATTAGTGACGTTCTGCCGCTCAAGAAGAAATTTCAAGAGTTGCTAAGCGTCAAGAAGCCAACGGGGGATCCAAGGTGCCCTGAAAATG
CCGTCCAATCCAGCGTCGGATCGAAGAAAAGGTGTCTGTGGAGAACGATGTTGGCGAAG