Description :
From Genome Similarity Track
Location :
Scaffold_2:102573- 107878
Sequence
5305 bases(100 bases per row)
AGATACTTCTTAAGACGCCCGACGTAGAACGTCGGGTGTAGTCGTAGCGACGTAGGAATGTCTAGCGTGTAGGCATCACCCATAACTCGTAGTACTTTGA
ATGGCCCAATGTAGCGCGGCGCGAGTTTGCTCGCGCCTAGGTTCATAATAGCAGAGGTACGAATTCCATCCGTTGAGAGTAATACACGCTCACCAATCTT
GAATGCACTTGTGTTCTTGCGGCCACGTTTGTCAGCGTTTTCCTTCTGCTTGTCAACCGCGAGTTGTAGCGCGTCACGGACGAATCGGGTAACCGATTGG
CGATGAAGGACAAAGTCGGATACCGCTGCCTTGTCAGCGGGTCGCGCTGGGGTTTCGGCGCGTAGTTAGCCACAGTCGAGTGTGGCTGTGCTGGAGCGAT
CAGCGTTCGGTGTGTCCAGTCAACTAACGGCGACGACGTGGATTGCGCGGGTGCGAGGATCTTCTTCGACTGTAAACGCGTCACCGCGTTGATGTCTACT
GCAGGAATAGCTGAACTCGTAGACGGCAGAACCGTTGTCTCACCGGAAACCGGTGGTTGAACCAGTATCGGAACCGGTTGGGCAGGGTTATCACATTCCT
CCCCCTCCAGAGTGAAGCCATCAGTCGCCGTGGGTTGGCCCACAGCAAGTTGTGCGGGGACACGCGGATGACGCGCGTTGTTGACGAAAAACGGAGTCAA
TCCCGTCGACGCGTGCTCGGCATTGTTGAGCGCAAACTCCGCAAGAGGCAGGAAGGAACCTTAGTTCTCGAAGGACGGGGCATAACTGCGCAGAACATCT
TCTAGCACGCGGTTGACGCGTTCCGTTTGCCCGTCCGTCTCCGGGTGCGCCGCCGTCGATATGAGGAGTTTGGTGCCCAGGAGGTCGAAGAGTTTCGTCC
AGAACGCCGATGTGAATCGGGGATCGCGGTCAGAGACGATTGATTCAGGAAGCCCGTGATGTCGGAAGACAGCGTCGACGAAGAGCACCGCGGTATCGCC
CGCGGTGATTGAGACCTGAATCGGAACGAGATGGCACATCTTGCTAAAGCGATCCACGAAGACCAGAACACCAGTACGATCGTCAGTGTCGGGTGGGAGA
CCGAATATGAAGTCCATTGACACAGAGCGCCACGCCTCTGTCGCCTGAGGGAGAGAACGCAGCGGAGCTTGCGATGACGGTGACGGCTTAACGCGTTGAC
AAGTTTCGCAGGAGCGGACCCACTTGCGCACCCACTTGTATAGGTGAGGCCAGTAGAAGTCGCGGTATACCGCTGCGAAAGTCTTCTCACGGCCCAAGTG
GCCACACACTGGAGCGTCATGGAATTCGTGTATAATTCTTGCGCGTAGATCGGGGTCGTTGGGGACAACGACGCGAGGAGCATCGAATCGATCGATACTG
TACATCAGTAGATCACCGTCAAGTTGGTATCTGTGAATCTGGTCGCGCGTGGAGCGGCTCAGTGTCTTTAGCGTGGCATCACTTGGTGTGCGAAGGTGTT
CCAGGATACCGGCATATATCGAGTCATCTCGATACGCGGCAGAGATCTCTTCCCGCAGGGGAAGTATTGGAGATACCGCCGTCATCAGGTTCACACCTGC
AGCCACACATGTGGCGCAGTCCAATTCGTCGTCGTCCGCGTCTTCAAGTGCCTGACGACCCACATCTCGGCGTGGATCGTAATCGGGGCGCCGAGATAGG
GCATCCGCAAGGATGTTATTCTTGCCTGGCTTGTAGTGAACGACGAAGTTGTACTCGGAGAAGAATGACAGCCATCGTGCCATGCGCTGAGAGAAATGAG
GGCTCTTCGTCGCTGTTCGCAGCGACGCGTGATCTGTGTAGATCGCGAATGTCTGCTCACCGAGTAAGTACACTCTGAATTTGATCAGTGCGTAGCGCAT
CGCAAGGAGTTCCTTGTCGTGAACCGGATAATTCTTCTCAGCGGGCTTCATCTGTCTGGATTGATAGCTCACGACGCGTTCGCGACCTTCGTCGTCGAAC
TGCATCAGTGCACAGCCGATGGCGAAGTCGCTCGCGTCGCAAACAACGTGGAATGGCTTTGCATCATCTGGAAGCGCCAGGATTGGGGCCTCCGCCAAGC
TTTTCTTCACTGCATTAAAGGCTGACTGATGTTTGGGAGTCCACGACCACGTGATGTCTTTCTTCAGCAATGAAGACAATGGCTGGATCAGACCAGCATA
ATTTTTCGTGTACTTGTGGAGATAATTTGCGAGGCCAAGCCACTGACGCAATTCAGTCTGATTCTGCGGCGTGGGCCACGCACAAATGGACGAAACCTTC
TCAGGATCCGCTCGGACACCATTTTTGCTCACATAACAGCCAAGCACCGGAATCTCCGGGGCACAGAAGATGCACTTCTTCAAGTTCGCGTACAGTTTAT
TTTCGCGCATGACTTGGAACACTTGTCTAAGTGATTTAAGTGAACTTCTGTGGCGCTGAGATCGCCCTCAGCGCGGCTGTGAACGAAGATGTCATCGAAG
TAGCTCGGAGCGAAGTCGCGAAGTGGGCGCAGAACGTGGGAAACCATGCGATTGAATGTGGCTGGTGCGTTTTTCAGGCCCTGCGGCATGACAAGCCACT
CCCACAGCATCCCGCTGGGAGTGCTCACCGCTGTGAGCGGGACGTCGCTGAGTCGCATCAAGATCTGATAGAAGCCATCGGTCAGGTCGATGGTGCTGAA
AATATCACTGCGGCCCATGGTGTCAAGTACCATATCCTTCCGAGGGATCGGCGTTTGTGCTGGAATGGTGGCGTCGTTTAGCTTGTTAAAAGCGTGAACA
ATGCGCCAACCACCCGTGGCCTCCTTCACGCAGAACGTCGGACTCGAGTGTGGCGAGGTACTCTCGCGCACGTGACCCGCTTTGCGGCGGCTCTCGAAGA
AGTCGTCAATGGCTTTAACCTGATCGCGTGGGAGGGGCCACTGTCGCGTCACACAGTACTTGGAACCCGGCGTGAGATCAATCCCATGGCGAATGCCTCT
GTCAGCAGGGAGCTCAGCTGGAATCTTGTCGGGAAAAACATCCGCGAACTCGCGGACGGTGTCGTATACTGGATTGCCCGAGTCGCGGAGTGACTCCCAC
GACTGGGCAGCGAAGCGCTCTTCGCGCGCCGACTTCGGCTCAGCGTTCTTTGGACGAAGTGGAAGATTGTCGGTAGCGACCGTGTGGATCTCTTCCGCCG
AGGCAGACTCGGTGATCAAGCAGACCTGCTCGATGTCTCCTGACTTCAGATCGCGCAGAAAATGCTTCCAGGAAAGACCCGGAAGGCGTGTGATGGAAGA
AGCTTCGCGAGGTAGGCTCTCAATGTCAAGTGTGCGTGAGCGAACGACGCCTCCTTCCACGTGTTCCAGGACGTGTATGGACTCATTCACTGCGATATCG
GCGGTGGGCTGACCACGTCGCCTAAGGCGGCGTCGCTTGGATTTCTTCTTGCGGCGTCTCGAACCGCTGCTCGAGGCAGAAGACTCGCTATCGCTGGACG
AGGGATCACCCCCCTCTAGACACGGAGGGGCACCATTAACCGTGTCGGTAGTGCGCGGGAGCTCTCGATGCTCGACCGCGCCATCGACAGGCGAGAGCCC
CTGCTCGATAGCCGTCGTAGCCGGTGGGAGTGTCAACTGCTCGACCACCGCTGTGGATGACGGGAGCTCCAACTGCTCGACCGCCGAATCGCGTTGCGGG
AACCTCTGCTCAACCGCTAGAGTGTTTTGCGGGAACCCATGCTCAACCGCCTTGTTGTGTTGCGGGAACCCATGCTCGACCGCCGTGTTGCGTGACGGGA
ACCCATGCTCGACCGCCGTGTTGCGTGACGGGAACTCATGCTCGACCGCCTGCTCGGATTGCGGGAGCCCCTGCTCTACCGCCAAAGTGTTAACAGCCTC
GCTTCGCAGCGAGGGGTTTTCGCGCAACAGCACTGTGCAAGACATACAGAGAGGGCCATCGCTCGCTCTCTGCTCAACCTGCATTGTGGACAACCGGTCC
ACGACCCTGACATGGGGCCAGTCCTTCTGGGCAACCAGGAGGTGAGTGAACACCTCACTCACATCGAAGCCAGAGCGGTGTTTAATCGACCGAGCCAACC
AGTCAATCTCTGGTTGATATCGTGACAACCACGGGATACCCAAGATGCAGTCGAACGCGTAGTTCATCTCAATCATGAGGAAGTCATCGTTGCTGCGGAA
GCCGTCGAATGTGTACGGCAACGTGATCTCGCGCCGCGCAACGCGGCGTGGCTTTCCGTCAGCAAGTTTGACGACGACCTGACCTCGACCATTACGGACT
GCGACCTCTCTTGGAAGCATCAATAAGCACGATTCACGAAAGAAGTTATTCGACGCTCCTGAGTCAAGGAGTGCGCGAAGTGGTCGCCGGGCGCCGGCGA
CATGAAGACTGACGATGATCAGCCTCGAGTCGCCCGACGTGATGGTGGCATTAAAGTGTGCGTGGAGCACAGGAGAGCTAGAAGGTTGGAAAGCCACCAG
GGGACCCGGACCTCCATTCCAGCCAGTAGGGCGCCCCGCACCTACTGGCCCTGACCGTTTTTTTACTGAACGGCAGGTGAGACTTCGGCGGTGTGCGCGA
GTACCGGCGCTGGCGCGCGGCATTCCGCCGCGCGATGACCGATCTTCCGGCAGCGGAAGCAAGTAATCGGGCGATTAGGACGGCCGTTGGGCCCACGAGA
AGTCGACTGATGGTGACTATTCGACGCGTCAATCGCGTCGATCTCCATGGGCTCGGGGGCTGACTCACGAGCTGCCGTAGACATCGCGCGCACGTAAGAC
GCCGCCACAACGTAGTCTTCGCGTAATGCGAGGGCGAATGCTTCCTCGAGAGAGGAAGGTTTCGCTCGGGTCAGGCAGTACCGTGTCATGCCTTCACGCA
TGCCGAATACGAATACATGGACCTGCGATGCTGTGTCAACCGGATTTGTCACGATGCATGACGCGAGGTGGCGAGTCTTTTGAACGTAGTCGCGCATAGT
CATTTTACCTTGACGAAGGGCGAAGAACTCGGCACGCACGCGGGACTCGTCTTGAGGGGGCTCGAACGCGAGCCTGAGATCTTTCTGGAGAGACTCCAGA
TGGGGGAATGCGTCGTGATCAACGACAAGTTTACCGAGGGCCCATTCCTTGGCCTTCCCGGACAACCGGGACAATAAGAAATTGACCTTTGACCCTTGCG
CTTCGATCATTCTCGAAGCAATCGCGATGTCGACCTCGCGAAACCACCGGTTCAGCGGGAGGCGATTCGCTCCTTCACCGGAGTAGGTAGACGTCTCTAG
CTTCA