Description :
From Genome Similarity Track
Location :
Scaffold_33:102563- 110257
Sequence
7694 bases(100 bases per row)
GTAGTTTAGACACAGCAGCTGTCAATACGACCTCATAAGTATGTGGAACTAAACGATTGCCGTACCAATTGGTTGAATCTGTGCGTCTGCGGTATCCCCC
CCCGACCCTGCCGGGCAGTTCCACATCACTCAGAAGGTCTTGGCTTCAGCAAAAGGTGGGCGTCGCTTGCCATGACGCATGAGCAGCCGTTCGAGGTTTT
TTGGGTGGCAGCGGAGCTCTGGGGGCTCAAGCAGAGCCGGCGCCCCGCTCGACATTTCGAGCGCTGTCTGTGTCTGCGTGCTTCTGGAAATGCAGTCCTT
TCTAAAATGGCATCACCTCTCAAACCTAGTAGCATATGATAATACCTTAGGTACGACCGATATGCACCGTTCTAGTAGACCTACCCCTGATTCTGGTGTA
CCAATGAACATACTCAAGACAAGTCTAATTCCGGCCTTTAATTGAACCTTCGCCACAATTCCAGTGGTTTCTTTAAGTAACAATACAGCGACCAACACTG
TCATATTATGTGCTAATCACCACCTAAAAAAAGGAGGGATCCCGGAGGTTTTCAGAGCTGTCAAAACTTATGACTTACAAGGCTCGAGTCCTAAGCAGTG
CCTTTTCGAAAATTGCACCTGCAAACCGGTCTCGAATTGACCACTTCCCTTACACATAACGATAGCGCTGTGCTTTTTTTGGAACAGCTCCATTGGCAAA
GGTTCTGTCAGTATCTTGAAGTGTATAAAAAGCGCATTCGTTGTCCAGAGATGTCACTGGACCCTTTGAATGTCACCTATGCAGTACAGTAAAACCTCTC
CTAAATGAGTTTTGAGATACCCGATATCCTCTAGTACATAATATAACTCACGTCCACCGACCTCCGTGCCAAATATTACTATGACGTAAACTTGATAATG
CTCAAATGGCAACTTGATACGAAATTTTGAGAAAGAAAGTGTACATGAGTACTTGTAGCCTACGTCTACGAAGTGGTCGTGAAAAACGTGTAGTTAATTT
TATGTCAGTAACCAGCAACCACCAGTCCTGAAATTGTTTGTATCATTCTTCGACTGTATCGAGAACTCATATGTTTCGAATGTGTTCTTGATGCAGTCGA
AGTCGGCAACACAAAATATGTATGGACCAAAATTGTAACCAGTCCGGACTAACGCGGATTTAAACCCAGGACCAAGCATGTGTAAACATCGCTCAGTGTA
ACGGGGTACGTATCCTCAAGTGTACCCCTAGTTACATGAAGTGTGACACGTTTACCTTCGGAATATCTAGTACAGGGTACCAGGTTCGCCCGAAGCCATG
ACGACACTGTTTTTCTGTACGTGACGTTTAGTTTGTAAATGTAATTCAGGCTTAGCTTACCTATAAATATATTCAGCTTACAACTTACCTTAAATTGATC
ACTTCGCTCCCTGAGGCAAAAGGGGGGCCTGTGAACCGCCGTTCACTGGGAGTTTGTAAGCTCTCGAAAGCCGATTTCCTCTAGCGCAAGGTGCTGTGTG
ACCCCGGCACACTTGGTAGCACTTATAGTCAATCCACGGCAGCGCGGGTAGACTTGCTGAACCTCTCTGAAACTTGTCGCCATAGATAGAAACGACTTCT
CCCATCGGAACGACTCACAGCTCGAGTCGGTTCGGAAGATGGCTGACATGTTCGGGACGGAGGACCTGCAGGGCCTAGTGGTGTCAACACCGGCTGAGCA
GCTCGAGCGTGTTAATGCGTTTGACGCTTACGAGCAACGGCTCATCGCACATGTGCGGGACACTTGCAGGCTCCGGCGGCAGAAACAAATCCGCCACACC
CGAAGCCAATACGGCCGAAGGTTAAGCTGTATGAAGGGAAGGCAGGTGAGAATCTTCACTTCTGGATTCGAGAGGTAAAGCTCACGATGGACCCGGCTCT
GATCTAGACCGAGCAACTCCGTGCTGCTTTTGCGCTCTCCAATCTTAGCGGTCGTGCTAAGAACTGGGTACACACGCGGGAGGCGACATCGCCGGGATGT
TTCACATCCTGGGTTCAGCTCTGCGAGCAGCTCCGAGCCTCATTCCTCCGGCGAACTACGAGTACTGGCAGCGTTCCGCTTCCTATCATGCAAGCAAGGA
AGGTGCGAGCTGCACGAGTACGCCTAGGCGATACGGGAGCTTACTGCGTCTAAAGTGGAAAGGCCACTCAGCGAACGCATCAAGGTGACTGTGTTCACGG
CCTTCGAGAGGGCCAACGCGCACTCATCTGTTCCGGGTGCAGTCAAGCACGCTCGAAGAGGCGATTCAAGTAGCCGTTCAAGAAAAGTACAGCCATTGCT
AGGCGCGTACGCCGACCTCAGCGGGACCAGGAAATTCTGGGTCGAATCCCGGTCGAGCAAACCCCACCGGACCAGTTTCCATGGAACACGGATCCGCCAA
GCAGCGCGACCCTCGCTGCTTGTCTGCGGGAAGCTGGGCCACTTCAAACGTGACTTCCCCGCGGAAAGACACCGCAGGCGTACGTTCCCCAAGCATGTCC
TAATGGGTAGGTGGCAAACGACAGGACCCCGGGAACAGGCGAACGCCAAAGACATATAGGGGCGGGGCGCACTACTGAGGAAGATCTAAGTCTTCGTGAG
GGGTGTGCGGGTGGCGAGCACCACGGGGACGTAGCCCCTAAAAGTCTTAACACTTTCGAATCGGCGAAGCGTAGCCGCGGGCTTCTCGTAGTACACGGAT
TTGGACAGGGATGCGATCACCCCTTTAGCATATTGATCGATTCTGGGGCGTCGAAGAATTTCACACGACGCCGGACGGCGGCTCGTAATAGCAACAAGCT
GTCCGATGCTTTGACAGAAAGCAAGGGCAACGGGACGGTGTCAGTGTGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCC
GTCAAGCTTGAAGACTTTAACAGCCTTGATCAGATTACTGTGTTCGACATTGATCCCTACAATAGGGTCCAGGCCATGCCCTGGCTCGCGAAAGACGAGC
CTTGGATCGACTGGCGAGGCAAGGCAATCAGTGCCAGCTGCCATGCGAAGTCAGACATAGAGTTGGTGAGTCATGTTCCCACTTCTGTCAGGACCCGGGG
CACCCGTAAGGGCTGCCAAGGTACCGAAGCATCGTACGGATGCTTGGGAGCCGGCGACGTATATGACGACTTCGAGGACGCTTCAATAGTGGCGGAACTA
GGCAGTGCTGACCCAGTGGGTAACGTTTGTCTACAGGCGGGCAACATAGCTCCATAGACAGCTGCAGCTGTCCCGAACGCTGGTAATATCGTGTACAAGG
TGGGTATCCGAGTTCCACACACGATCGCACAGACCTTAACTGAAGAGGAAAATGTTGGATTCGCTTCCTGGGTGTGTAACATAGTACTACACAAGGCCTC
GAGTGTCTCGGATGTCGAGACCATGACATCCTCAGACGTGGGTCACAAACTTTCCGCGTCACGGTCGCCGTCGACGTCGATAATGATGCCGCCGAAAGTC
GGATCTGAACTTCGTTCAGATTGACGTCGCTTCACGCGGCTCGGACTCCAGAGCCCGGGCTCCTCCGACAAGGCCAGCGGAACAGTGTTATCACATCTTC
GATAGCCAGACCTGTTTACCCGTCGAGGCGACATCCCGCTTAACACGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTAGCTCGGCATACCAAAGGGTTT
ATCGAACGCCCCGGCGACATTCAACCGTCTGGTGACGCAGCTGTTCAGGCCACTACGTGCCTTCGTACAAGCGTACTCTGACGACATCTGCGTCTATAGC
CGTGTCGAGGGAGGCAAAACGGACATGGAGGTGCATTTAAGCCACCTCCGCCGAGGGTTAGACCTGGTCCGAGCTAACAAGCGCTTTACCAACATTAACA
AGTGCATCTTCGCATCACGAGAGATCAAGGTTCTTGGCTGCTTCATCAACAACGTGGACGGTCGGGCTGACCCAGACAAGGTCCATGCCATTGCAGCATG
GCCAACGCTCCGATCCCAGACGGATCTTCGAAAGTGGGTGGGTTTGCTCAACTACCTTCACAAGTACAGCGCAGGGTACATGGACCTCATTAAGCCCTTG
TCGGGCCACCTTCATAAGGACGCCTACTGGCACTGGGAGCAAGAGCGCCAGGATGCCTTTGACGGCGTCAAGCCCAGCCTCCAAGAACACTATGTCCTGT
CCCTGCCGGACGAGACGAGGACGTTCAGCGTCGTTTGTGATGCCTCCGACTATGCCATCGGTAGTGCATTGCTGCAGGCCGACATAGCTGGACACGAACG
ACTCATCTCGTTCCAATCCAGGCAGCTCGATGCCGCCGAATGGAACTACCCTATCCACGACAAGGAGCTCATGGAAATATAGTATGCCCTTGTGAAGTTT
CAGGTTCACCTTCTGAGCTCACGGCCCTTCGTGGTCTACACAGACCACGCATTCTTGAGGACGGCGACAAATTTGCCCTACCTTTATCAACCGATGGCGA
GGTGGCTGGCCTTCTTCGCGGAGTACTATTTACGCTTTGAATACAAGCCGGGCAAGCTCGTGCTTGCGGAAGCCCTCTCTCGGCGTCCAGACTACGGGTT
GGCCCACTTCACCCGGGTGACAACCGATGTATTTGATCGGATACGCGTGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTAGCAGCA
GCAACGAACGTGAAGTTTGACTGGCTTTCGTCGCGACAGCGTTCCCGGCTCCACCGATATGAGTTGAAGGATGGTCTCCTCAATTACCAGGTGGATCCTA
ATACACATCCACGGGTGGTCGTACACAACGACGAGGATCTATAGTTCGACATCCTTGCGAAAGCGCACGACGCACCCTCCAGTGGTCACTTGGGTCGCGA
GAAGACCTTCTTGTCGGTCGCTCAGGTCTTCTAATGGACCCACATGTACAAATGCGTCGCACGATACGTGAAGACATGTGAAACATGTCTGCGGGTCTGC
AGGGCACGCTTCGGGCCCACTACAGAGCCTGCCCGTTCCGGCGGACTGTTGGAAGACGATGGGTCTTGACTTTATCTATTGACTTCCCGCTGACGGACAC
GGCAACACCGGAATTTTGGTGCTCGTGTGTTGGCTAACCAAGATGATACATCTTGCTCCTGTACTCGTCACTGTCACAGGCGGGCCGATCGCAAGGTTGT
TCGTCGATGGCGTGCTCCGTTATCACAGTCAATTGTCTCGGATCGAGACCCGCGGTTCACGGCTTCGGTCTGGAAAACGCTGTTTCAATTACTAGGAACT
CGTCTGCAGTTGTCCACTGCTGACCATCTGCAGACAGACGGACAGAAAGAGCGCGTCAATCGAGGGCTCGAGGACACTCTGCGCAGTGTGTATCACGTAC
GTGGATGACGCAGCTTCCGGTTGTTACATTTGCGCTCAACAACGCGGTGCACACGTCCACAGGGCTCACGCCGTTCTACTTTAGTAGCTTCCTCACCCAG
TGTGCCTCTCACTCTTCGAGGAGACACTGCATCCGCTATCTTAAGTGGGGGAGAGGCTCGGAAAGCTCTTTCTTCCCAGGATTCAGATGTGAGGCCGTTT
TCGCTGCTGGCCACGCTAAGCGGATACCACGCTTAGCGTGATGAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGACAGACAAAAGGCGTACTCTGAC
AAACATGGAAGAAGAAACTTAACCGTTTTTAAGATGCGTGAATTAGTGCTATTAGACACGAGGAATCTACGGCTAAGCGCTATCGGCAACAACAAGCTGA
AACACCGATTTATTGGACCGTTCCCACTATCGGCAACAACAAGCTGAAACACCCATTTATTGGACCGTTCGCAGCCCTGGCCAGGCATGATGCGTCGTAT
ACCATCGACCTGCCCAAGTAATGACGACGCACCCGACGCTCTCCGTTGGACGTCTAAAGCAGTACCATGATCCGCAGGAGGTTGCTAACTCGCAGATCCA
CCTTGGTCCATCTCCTCGAAGAGATGTTCGCCCACAGACACCGACGAGGACACCAGAGCAGGCTACCAAGTCTCAGGCTGAACAGCAAGGCTGCGGTCGA
GACCGTACGGCGGAGGTGCCCCGTACGAACGGTCCCCAGAGCCATACGCCGCGTACGCCGAGTACATCGGGTACGCACCATACGCGTACGACTGGGAGTG
CGCTGAAAGCGGGTTCGGACGTGACAACAGAGTCTCAACACGTCGGCGCATACGGAAGGCCTCGTCAAGATCTGACGAAGAGGCCCGGTGGTCCACTTGC
AGATGCAGGCTCGAGCCTTCCGCTCCAACAGGTCTAGGCGGCCGGCAAGGCGAGCTAGCATGCCCTGATTCCCGGTCTGGGTGGCAGCCCCAAGGCCAAG
TGCAATCGCAAGCACAAGGACGCGCTGACGGAGGCGGTCAGCCTCAGAGCTCTGCGTCGGGCCCGCAGGAGAAGCACGAGGACGAGAGTAGCATTCCGGG
GGCGCCAAGCACTCGCACTTGTACGAGGGCACCTTCACTCCTTCTTGACTGGAACGAAGCGGTCCACTACCACGTGGAGCGGATCCTCCAGGCGCAACGG
CGTCGTGGTAAGCGACAGATCTTCGTAAAGTGAAGAGGTTATGGCCACTACGAGAACTCGTGGGAGCCGATTGAGTGACGCCTGATAGACTGCCTGAAGA
CTAACGAATCTGGGAACAGAAGCGGTGGCAGCTTCGTAAGTAGTCCAGGGCTTCTTGCCTGAACGGGGTACGGACGTTGACGCCACTCCGTACCCGCGCT
CATCATGAGCGCTAGAAGCCGCGCGCTTCAGAATATCGCTTGGTAGCATGCGCTTGCTGGCCAAGTAGGCAAACCGGACACGAGATCACGCTGGTCCAGG
ATGCGGAACAGCAGCTGATCTTCATGGAGTTCCCGTTGATCCGAGGATGGATACTTGAGAGACTCCACGCAGGCCCAGAACATGTCATCACACGAGTTCC
AGTTGGGACAGTTCTCGAATAGAACCCAGGGGTAAGCCACAGAGCGGGTAGAGACCACCCCGGTTCTCGGGCTTCTTACGATAAGTCGTGAAGTCTTTTA
AAGGAATTCGGTGCGGTGCGAGAAGTACGCACCGAGTCGCCTCCAAGTTGTCGACGAACAACTGATCCTTGTGGACCAGGGTTTGTTCGTAAACGCTCTT
AGAAGTGTGACCCCCAACAAGGCCACGTGGAGCGACGAGAATCGCCAGAGCCAGGTCAGCCTTAGAGATCTCCTCGGTAGGCCAATAAACTCATGCGTTG
ATGGCAGCTCCCTGGTTGACAGGTGCCACCCCCAAACCCTCACGCATGCGCCGGGCAGCTTGGAAGTATTCCTGCCGATGGTCGATGTCGTTCGCGATCT
CGCGAGGCGCATGGATAGCACCCTCCTCTTCCTCTTCACCCGAGGAGCCGAAGAAGTTTCAATAGGAGTAACCAGTATTATTTTTCTCCCGGAGTGAAGA
CTTCGAAGCCGTGCGCTTCTAAAAGGGCTTGGCGTATTCAGCTTTGGTTGCCTTAGCATGCGCAAGACCCTCGATTTTTTTCTGTCGTCTGATCACCGCA
TCATATTTTAATGATCCAACGACCGTAGTCAGCCCGTTCTACGCGGCTGTGCCACCCTTCTAGAGATCAATTGTCCGATGGCCAGCCAGCAGAC