Description :
From Genome Similarity Track
Location :
Scaffold_14:102558- 103775
Transcript NameFunction/comments
Aphas_H257_06119predicted protein

Sequence
1217 bases(100 bases per row)
AGAACCCTTGGACACAAATGGCTACGTACTATAGTCAGTTTCGGAGCAACGACCTCTGTTTGTACGAACCCATGGAGCAACTGGACCCAGCCCATCCCGT
GTTGCCTCGAGGCGCCAACGGGTACTTCTGATACAGCACCGACTGGGTTTGAATGCACTCGCACGTGTCTTTGGAGATGCAAATGCCGTGGTGCTGACAC
CCCGTCACATCCCCCGCAGGCGTCGTGTACCGGCACAGCGGCAGTTGGCAGTCAAAACCCGTGTACCCATCCGCACAGCTGCACACGTCTGGCCGGACAC
ACGAGCCCTTGTTGTAGCACTCGTACACGCCTTCGCCCCGGGCGACCCCCGGGTGGTTCAGACGGACGACGCGATTGGAAAACTCGCCTTGCTGCCACCG
CAGCACCCTGCAAAGCGCCGCGTCGGACTGCCGCCCAGTCGTGGCCGTGTCGTTGTACGCGTCCCAGTTGGCCTGGTTCAGCGTCGACGGGCCGGTAAAG
ACGGGGTTGGGGTACGGAATACCCGGCGCGCATCCGGATTGGAAGGACGTACCATCGTTGGATGTGAGCTCAATGTCATACTGCGGACAGCGTAAGTGGA
CGCATGGCGTCTTGTGCAAGTCGCCTGAACGCCACACACAACGAAGCCATAAAGCGTAGCCGTTGAAAAGTATCATCAAAAGCACAACTCTGGCGAAATG
CATCGACCAAATAAACATACTGTATATATACCTCGCATCGCGACAAACGTGGGGGTGTCTCGAACAGCATTCAAGAGGAATCGCTGGGCTTGGGTGCAGA
TGGGGGTATTGCAGTCGTATCCCGTCCATCTACATGTTATGCAGTTTAGGACATGGATATGTACTCAAACCACGAGGCAGTAGTACCCCGTCAACTGGGG
CGATCCGTCGGGAAGGAGAAAGATGGGAGTACCGCCGTTGCGCCGGCCGTTCCGCCACGCGCTAGCCCATGTCGGGCACTCACACGTGTCCTACAAGCAG
TAGATCGATCCTCATACCATCGTCCGCATGAAAGAGTTTCGTACTGGAGCGACACAGCGGCCGCCGTTGCGGCAATCTTGCGCGCATATCGCCACCGAGC
ACACGACCCCCGTCCAGCCCAAATCGCACGTGCATCGGTTGGGCAAGGTGCAGGCGCCATGGACACAAGGAACAACACAAATGGGGACGGAGCAGTCGGT
GCCCGTCCACCCCGTCG