Description :
From Genome Similarity Track
Location :
contig_43:102525- 103833
Transcript NameFunction/comments
g7463.t1POM68692.1 Pyruvate kinase [Phytophthora palmivora var. palmivora

Sequence
1308 bases(100 bases per row)
GCTTATTCCACAGTCAGCACCTTGAGCATGTTGGTCGAGCCCGAACGAGCCTCCACCATGCCGTGCAACGCAACGACGTTGTCGCCAGACTTCAGCCAGC
CGAACTGCTTACCCAGATCCGTGGCGCGGAACAGGATCGAGTCCGTGCCGATCATGGAGCCCATGCAGCGAGCAGTGACACCCTTATTGAAGCCCTCAGC
CTGTCGAGCAGTTCCACCCAAAGCCGTAAGAACCAGCACCGGCATCGAAGGACGGAACTTGGAAACCAAACGCGCCGTGTTGCCCGACTCCGTCAGCACC
ACGATCATCTTGGCGTTGATGTCGATGGCCGTCTTGACAGCCGATGACGTGATGGCCTCTTGGGTGTCCATTTGGCCATACGTGTCGAGCACCGAGTTGT
GCAGAGCTTGATACAGCTCGTTGTAGTGGATGGCACCCTCAGCCTGCACGCAGATCTTGGACATCATCGACACGGCTTCCGTCGGGTAGTCACCGTTGGC
CGTTTCGCCCGAAAGCATCACGGCGTCCGTGCCGTCCAGCACGGCGTTGGCCACGTCCGTGCACTCGGCACGCGTCGGCCGGGGAGCCTTGATCATCGAC
TCCAGCATCTGCGTGGCCGTCACCACGGGCTTGCCAGCGATGTTGGCCTTGCGGATCATCATCTTCTGCGCCAAGAACACCTTCTCTGGCGGGATCTCCA
TGCCCAGGTCACCACGGGCGACCATGATGCCGTCGGTTTTGGCCAGGATCTCGTCGAAGTTCTCGAGTCCCTCCTGACTCTCGATCTTGGCAATAATCTT
AATACTGCGGCCACGAGGGCCCAGCACCTCGCGGATGTTGTCGATATCCTGACCCGTACGCACGAACGAAGCGGCGATGTAGTCGATGCCGTGCACCAGA
CCGAAGTTCACCAGGTCGTCCTCGTCCTTCTCCGTCAGCGTTGGGAGCATCACCTTGCATCCAGGCAGGTTCATGTTCTTGCGCTCACCCAGCGTGGCCG
TGTTATTGGCCGTCGTCACGACGCCATCCTCCTTCACCTCCGTGACCGTGAGCACGAGCGAGCCGTCAGCCACCAGAATGGAGCCGCCGACCTTCACCGA
CTGCGGGAGCTCCGGGTACGAGCAGGCGATCTTGGTCTCATCACCCAGGAACTCGTAGTCCGTGGTCAGCTCCAGTGTCGAGCCCTTTTTGATGGTCACC
TTGTCCTTGTTAGCCAGGAAACCCGTACGGATCTCGGGGCCCTTCGTGTCCAGCATGATGGCCACGTTCTTGTGCGGGCGCGTGGCCAGCACCGCACGCA
GGCGGTTG