Description :
From Genome Similarity Track
Location :
contig_85:10251- 33172
Transcript NameFunction/comments
g12837.t1hypothetical protein
g12838.t1hypothetical protein

Sequence
22921 bases(100 bases per row)
CAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCC
AGTCTCGTATCCTCGGTTACTTCGGGTGCTAACCGACTCTTCGGTCGGTCTCCGAACTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGA
ACCTATACCCACTCCGGTCTGGCAATTCCAACTCGTACGCAAACTCTTCGATCTTTTTCTTGATCCTGAATGGCTCATGCCATCGGTGGGCGAGTTTCTT
GGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTCTGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGTCAGATGTTGCCCCCG
TCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCATCGACATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCG
AGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCG
AATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAG
AGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCAC
CGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATG
AAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTG
ACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAACAGTAGTAGGGCTGAGTTACGAGACTTCGGTAACGGTATGACGAAATCCATCGACAC
CATCTGGAACGGTTTTCCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCA
TATAGTCCAATCCAAAAATAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTT
CCTGAATCATCGTTGTGGGCACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATC
CTCGCTAAGCACGAACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGAC
CATCTCAGCTCTTCATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTA
CCTCGTTGCTCGATTGCTCGGCTCTCAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGA
CGTTTCATCTGCAAACTGGACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAA
GATCTGTCGCGGGAGATTCCCGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTC
TCCGATCCGGTTCAGCTCGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCT
GCAGCGTTGAATTCTCGGACCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTC
GACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTT
GTTCATTCCAGCATACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCAC
GAGCAACTGCCATATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGT
GGGGGTCCATACGAGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAATCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGC
TGAGCAAACGTGCAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGA
TTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAG
ACCTCCTTCTCGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAG
TGGAGCTCAATGCCCACTCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAG
CGCGCGAAGCTTCGTTTGGCCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATG
AATCGACTGTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGC
TCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAAC
CGTTGGAGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATCATCGACAAACGACCGTCGGTCGAACACTGGCACCA
ACGAGGATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGC
CTCGAATTTGGTCGACCGAGTTGTTGACTCCTCGGGTTGTCGCAGTGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGC
ATAAGCTCCGAAAGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCC
AAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCC
GCATCAAGCGAGCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCA
GCTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGC
TTTCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATA
TCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGAC
GGGCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATA
GTCCGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCACTACCTGAACCGTCCCCCGGGTAATCTCATGCATCATTGCTAC
GAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCG
CCACCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGTCGGTTCC
TCAGTGCCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCG
TTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGC
CACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTG
AGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCAC
ACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTT
GCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGG
ACTCCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTA
GCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGGTCTGGAACTTCGCGCAAGCG
CAACCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGC
AATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGA
TTTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTC
CTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGT
TTGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGA
GAGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGC
TTAAAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGT
CTCGGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGC
AGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATAC
TCCTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCCACGCGCGTCCACCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTG
CGTCAGTGAGAGTGACCCTCGTCGATATGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTC
GGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCC
AGATTTTCGCTCTCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGG
TCTTCGCACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGT
TGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACGC
ATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCAT
TCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGA
TGTTTCCGAGTGGGAGATGCGTGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACAGCGCTCAGCTCACGAATTTGGCGTGCCCATTCTCCCGTC
AAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCATCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCGCTTCGTCCAG
CAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTCGGCGTCACCATGTGAGAGTCTTGGAAATACGTCGA
CGTCGCACCTTGGGCCGAAAATATTCCGGCCTCGGTCGACTTTCTGGGGCGTCTCCCAGGGGTCAATGGCAACGGAATCATGGACGGGTCGACCGGATCC
GATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGT
CCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCG
AGTATTCCACGACTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTC
TTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCAT
CCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTT
TCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTCG
TCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCGG
AACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCTT
TCTTCTCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAA
CACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAG
GAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTA
GAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCG
GGTAGTGAAATACACTTGGGAACTCTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTG
ACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACGAAG
ACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCT
ATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACATAGCCGAGGGTACGGCATGAAATGGGTACAAACGAG
GCTTTTAATCTCGGCCGGGGTTTTATTAGACCCAGCCGAGAATTGTCCCTAGGTCACTATAGCGCGGGAAATGAGACCCGCCAATCAAGACACTCTGTCG
CCGTTCACTGAAAGGTGCAACGTCCGCCAGACCGTGACAGTTCGGCACCAAAACCCAACGCCACAGTTTTCATTCGCCATCTCTTTCATTAATTAAACCC
AAGATCCTTGTCTGCCTCATGAGTTTCTTGACCAATGTCCCCTATATCTGGGACTATCCTCTTGTCATTTGGCAATGACCCTGTAGGATTAAAATAATCT
GCAACCTTCCAACGATAGTGGTCTAATACTCTATCCATATTGAAACGTTCAAACAGGCGAAAGTTTTCCACCACGAATAGCATCAAATCTCTTCCACTTG
CCTCGTTGTGATGACGCTGAAACGACCGCTTAATGTACCCGGACATGTATTCTATCGGATTAAAAAAAGGGCAGTATGCCGGGAGAGATATTGGCCCGAT
GTCGATGATTCTCAAAACGTGAGCGATATCTGGATGTCGGTAAATGGATGCACCACCCAAAATCCACACAGAGTACGATCCTGGATGTTGACGCACCTTA
CCTCTGGTAGAGTAGTCGAAGTCACTGCGAATGGCAAACGTGTGCCCTCTAACAGAACACCCCCTTTCCTTATCATCCCGCGATTGTCGTAGGTGCACCT
ACTTACGCCCCCTCCGTTTCGCAGGTGACTTTACTTTTATTTACTGTTATCACTTTGGGTATCCTTTGAGACGCCGTGTGCAGCCTTAGACTTCAACAAA
AGGTGAGTCACGTCCTGCAGCTTCTTGTCGTATGCCTCAGCAGCATCAAACGGTGGCCGCCGCTGGTCAGACGGCACGCCAGTCTTTATGAATCCACCTA
CGATCGTGCTCTTTGACAGCCCATTCCAGCTTGCATGCAGCCATCACACTACAACCTCACGTGTTGGAAGACTCAGTACAAACTTACCACCGTCGCGTTG
AATCTGTCGAAATTGTTGCTCGATGTCCGCGAGCCACTAGGTCCACAACCGTAGCTTCAACGGGCGCCTCCATGCGATGACGGCTAGTTGGCACACCGAT
GTGTAGCCACCCGGGACTTTTAACATCACAGCATTCAGCTCATTGGCGCATAACTCTACCTCAGCCGTCCAGTGTCCGCTGAACTCGTCCCAGATGAGGA
GAACGGGATCGTCGATGTTTGGCTGCGTTGCAAAGTGGAATTGCAAGAATTTCACTGAGAGCCCAGCATTCCACCACCCGCGGCTGTTGTAGTAGATCGG
CATCCGGTCGATGCCTGCATAGCTTTCACTTTCTTCCACAGGCCACGGCCAAAACCTTGCTGCTCCGCACGATGGTGAAGCTCCGTAGCCGGCACTCGCG
ACGGTGGCTACTTGAACACAAGGAAGAGGACTCGCTTGACTCCTCTTGAATCAGCAAGCACCATCACTGTGAGGCGGCTCTTCTCTTTGCCACTGTTGCG
GACCCACTCTGTTCGGGTGCCGGACTCGTCAATAGTAGATGCTCAAAGTTGAGAGCCGTCTGGTCGGTGTTGTAAACTTCCGTGACGCTGTGCTTCAGCA
TCGTCTTCTGGACTTTCTTGCGGTCTGACACTTGGCGAGAATCGCTGGGTGTTTGCTGCCCGATCCGGGTTCGTCGCCGCAGCGAGAGCCTGAACGACTT
AGGAAACGGCGACGCCACGGCGAGCTTGCCGAAAACTGGCCGTCGCGGAGCCCAATCATGGCGGCCACAGCACGAGCCTTCATTTGCAGCATCAGCGGTG
ACGCTGTTACACCTTCCCGCGTTAGGTCTCGACCCAGAAGGCTAGGCGGTCCTCCGCAGCCCGAGGCAGAGTGGCAGCCTACGCCGATCGTGGCAATTTG
CACAGGTGTCCGTTGCCGAGCGTGACTTGCTTTGCGATCTCTGCACTCTCCTCAAGCCACTTGTGAAGCTGGTGCTTCGTACGCTTGCGATTCGCTGCTT
GGAGAGGCGGGATGAACCGAGTTACCGCTGCTGCCATGCGTATTTATCGATGTAGCCATTTTATGAGCGCTTGCGCTGGTAACTGACAGCCGTGCGCACA
TACTGGGGAGTGAGCTCTGGAACCCTTTGATGCGGGGCGGCCTTCTCGCGCATGCGTTGCTGCCCGTGCGCTCGAAGAGTGAGGTGCCGATGAATGGCTA
CGCTCGTGGCTTACGAATTGACTGGTGGTAATTATTCGGAGTGGCTTTTGACATGACATGATATATGACCAAAATAGAGCGATCTGATAGGTTGATATTT
TTAGAACCGTCGCCTGCAAGGGGTGCCTTTCGATAAGGTTTTTACGGCATGGCCACACTGACATTCCTGCACGAGAGTAAAGTTTGTTGACGTAATCAAT
CCGTGGCAACCTGTACTTAAATTCAAGGCGGGGCATCTTGGCATAGAAAATCTAGACATCAACAACATGGAGAGAATCTCACGCGGTCGAGATTGTGATA
GCTAGCATCCAAATCTGGTGACACGACAAAGGCGAGTAGCATGCACTCACAAAACGACGAAACGAACACGAAGAGCGACAATGGTAGTGTAGGACAATCT
TCGTCTTTTGGATGATCGAGATTGCAGTAACTGATTGTTTGAGCGGTGAGGCCTACAATCAATATACAATCTATATTTCCACAGCTCTGCCACGAACCAA
TTCATGCTGCCACGAAAACGATCATCTGGACAGCGTGCTCGAACGTTAGGGGTCACAATTGTGTTCGCCCTGCCATGAGAGCTGCGACCATGAGCTGCGT
CTGAAATATACACCACAGAATCCATATTAGCACACAGTTGGCACACCACAGCAACCGTGGCCCGTACCTTTGGGTTCGGCATCGCCACCAACTCCAACAC
GGCGTTGATAGGGGTGAAAACCTCGCAATGACCGCAGCTAACACAGCGTAATTGAAAAGCGCGCTTCGGTAGAGCAGTTTGTTTTCCCAGAACCCTTCAT
GAATGGCTGCCCCCGATAGTTGGCCACGAAGGTGTTCAATTGCAGATCGACGACATGAGAAACATGATGCTGTTGACCATTCGGGTGGAAGCTGCCATCC
GGGTGCATCGCTGGATCTCCTGGCTCAATGAAGGGTTGCGCCACGCGAAGAGCTGCCGCTAGAAACGCTAGATGGATCACAAACTGACCAAAGATCGACA
CCAGCACGGAGATGCAGAACACTCCAGACGGCGGACGCTGATGCGAAAGCTTTCGTGCGGGTTTCGCACGAGAAAGAAACAAGAAGAACATCGCAATGGA
CAGCTGGACACACACAAACACCACATCATTAGTAGTGTTCGACTCGGGAAACATGGCGCAAATACACTCACCCCCGATATGGTGAGCTGCTGATCGCCAT
TTTTCACGCCAAGGATAAAGAGAGAGCTTAGGTAGTACGCCGTGATTAGACAGTTGATACCCAGAATCTTGTACATCTGGATCGTAGTCACCAGCGTACA
TCGTCCCTGGCGGATCAGTTTCTTGATCACGCGGATACTCGAGCTCTTGGAGGTGAACGGAGACGCGATGGAAGCATCTCCCAAACGCACAATCTGAACA
TCATCGTTGGTATACAAAGACTGCTGCAACTCTTCCACTGAGTTCCCCCTGCTCCCAGGGTGTCGGCGGTGGCGAAGACCATTCTGAGCCGTAAATCTCC
CCGCGCCTCTCCCTGCGTCAACCACATGAGGGGGATTCTCGGAGCTGGACGAATTCACAATCGAGATACCGATGTGCGCTTGCTTCAAGGCACCCACGTC
GTTTGTACCATCTCCGCACATAGCTGTAGTCTTGCCGCGCCGATTCATCGCCATAATGAGATGCTCCTTTTGTTGAGGTGAAGTGCGAGCAAACACCGTG
ATGCACAGACAAATCTTCCCAAGGATAGCGAGAAAGCCCTCCAGCGCAGCCGCACTATCGCTGCACTTGTCTTCCTGTTGCTTGTAAAGCATGGCTAACG
CTTCTCCGGTCACACACATATCGTACTGAACTTGCATCTTCTCCACTCCGTCGACATTGAAAGGAATAGTCTCCTCCTCGATGTCAGGTGACCCGTCGTC
GATGGACTTCCACTCCACAACTCCACTCTCAGTGTTCGATGTCAATACCAATGGCTGCTTGGAATATTCCGAGTTAATCCCAACTTGCCGGGCGACATCA
CACGCAGTAAGAGGGTTGTCTCCTGTGACCATAGTAACTTTGTGCTTGGAGATCATCAGCTCCCGAATTGTTCGCTTCGTGTCATCCTTCAGTGGGCAAT
CCATGACCAGGAATCCCGCAAATGTTAGTCCACCTTCCAGCTCACAACGCGGCTTGCGCCGTAGCTCTTCTGGGGAAATTGCTACAGGGAGGACGCGAAA
GCCTAAAGCCAAAACGCGACATCCCTTTGATGCATAGTGGCGGTAAACACGACGGTAGTACGAAGGCTTTGTACTAAAGATCGGCTCGAGTACTTCAGGC
GCCCCTTTCGTAAGCACCCGCTGCTCGTCTTGCTCATCGTTATCAGCCTTTCGCACAGTTACAACGGTGGTCATGCGCTTGAGCTCCGAGGAAAACGTGA
AGCTGTGCAAAATATCAACAGCTTGGATTTCTCCCCGGCGATCAGAAAAAAACGATGGTTGAACACTTGGGAGTGCTCCTTCTCCATCTTCGTTGTTCTC
CAAACACCACTGAATGCTTCGAACAGCCGTCATTTCCAGCGGGTCTCCAGCAACTTGGCCATTAAGCAACACCAATGACTGACAACCAGCAAGAACGAGC
TCTGTATCTAGAGGAAGTTGCTCTGGTGCAATGATATCCAGCTCGCCCCGATGCTTGCTCCTGGACTTATCAGGCTCAACATGTGTCTCCAAGCCAGCCA
CGCCGTGAAGCTTGAGTTCATCGCTGGTTAATGTACCAGTCTTATCGAAGCAACAAACATCGATGCGCCCCGCGAAGGGGATTCGAAACGGCTCGGTGCA
AAAAATATTACTTCGCGTCAGCGCGATCAGCGAGTTGGTCACTGCTAATGACAGCTCCATGGGGAGCTCGGGCGGCACGACAGACGTGATGATCATAATA
CAGTGAAGGAACAGTTTGAACTGGTTGCGTGTCGGATCATTTATTCCTTGTGCGAGCACAAACGCGGCTGCAGCCACGGCAAAATTCAGCAACAGAACGA
TAAACCACATCGCTTCCGAGTTGTTTGCAGTAACACGCTGCGACGAGTACAAAATAGTCCGCATGAGACTTCCTTGCGTCGTGCCAAATCCTGTCCGGAG
CACAAACCCAACGCAGCCTCCATCAGGAGGTGTAGATACACGCAGCGAATCCTTCGAAACTGGTGTAGTGTGCTGAAGAATTTTAGTGCCCCCATACAAT
ACATGTCTTTTGTGTTTCATGCTGGAGCCATCGTCAACCTCGAGATTCTTTAGTTTCTCTGCATCATTCACAATCGATGCCATCACAGCCTCCTTGCGCA
AAGGAATGGATTCGCCAGAAAGCATGGACTCGTTCACCACACAGTTACCACGAAGTAAAAGCAGATCACACGGCACTACCGGTACGGTACCGCGTTCATG
GTGCCCAATAGAGCAGATATCACCGGGAACCAGCTCGTCACTTGACACCTGGGTCCACGTGCCCAACCGGTAAACCAGACACGGCTGTGGAGCGCGGCGC
ATGTGCAGCAGTGTGTCCATGTTCTGCTGGCGCTGCTTGACCACCGTGCACTCGAAGATCACGAGCATGAGCAGCGTCAGCAGCGAGTAGTACATGTACT
CGTCGAGACACCAGAGCAGCATGCAAAAGAACTGGAACACGAAGAACGGCGCCACCAGCTGCTCCTTCAGCAGCTCAGTGAAACGAGGCATGGGCAGCTC
AAAGTCGTTCCTTCCGTACTTGCCTCTCGCCTGCTGCAGTTCATCACTCGACTGGATGCCTTCACTCTGCAGATAGGACGCCAGCGTGTCGCTGGACGGG
AACTGCAGCCGACGGAACTGCGTGTCGCTGTTGCTGTTGATGGTCTCCACGTCCTCGTACAGACAGAACTTGAGGTTTTGGTACGAGAACCAGAGCGTGG
GCACCTGTGCGTCCTTAAGCTTCTTGTCCTGGCGGTTCAACTGGCATTCGCAGAGCTGCTTGGGCAGCATCGAGAGTGACGGGTCCACCTTGGCCAGCAT
CTGGACGCGCTTGTCCTCGACCACCGCCTTCAGCCGGACGCAGCTCATCCAGCAGCGAACGTCCACGCTCCACTCGGTGCCCAGCAGCGCCAGCGCATGA
CAGAAGACGATCAAGGCGCCAAAGACCCACGGAACAACGTCGTCCTCGGGCCGCAGCGTGTACAGATATGCGGCCGTGGCGTACAGGAAAAGAAAGGGCA
GCAGGTCCAGCCGCATGAGCCACGGTAGCGGCGTGTACAGCGCGACGGACGCGAGCTCCGCGTCGGCCACGCCCACGGTCAGGACGCCCATCGTCACTTG
CGATCCAAAACCGAAAATGAAAGGAACGCTAAGTACGGAAAAGGGCAAGTGCAACGTGTCAAACAGCGAGATGGCAGCGGAAAGGATTTTTCACCGTAAA
GTATACAGTATTGTGCATTTGCTGCATCTCTTCATACGGAGAGAGGAAGTAGGTTGTGGAAGGGATTCGTCAGATCATCGTAGTCTTAAGAGTTTGTGTT
TCGTCAGCTCACACTTGTGTGCAAGGTCCGAATAACCAGATAAACAATCATCACTCGATCCCAATGGTCTACAGCTGCAGCAATGTGACTTGCGCGGGTG
GCGTTTTCTTCAGGGAAACATGGTGTCCTCATTCAAGTCAGACATACGCTTGTTTAAAAAGCATCAGCAGAGAGCCACCACCACGCAAACGGCAGCAAGT
ACAAATGATACATTTCTACAACTATTCACATGAAGCACTGTCTGGAGGCAGTGCACAATACACAGACGTTTGCAGCGAAGCCTCAGTTGGTACCCGAAAA
AGTTGCAATCGACATGAATTGGTCCGTTTGGTGCAATATAATCACTGGCTTTAGCAATCGATGGGGACAGCAGGAAATTGCATTGGGCTCTGCGCCGGCG
AGTTTAATGCGCGCGCGACGAGGAGCAGAAGCAGGAATGAATAAGGCGAACGTGGCGGCATCGCAGCCGCGAATTGGTTGGCTGGCTATAGAACACTTTT
TACGTTCGTAAAAAGGTAATTACGCAAACTCACATCTATGTACGTCACATCAGCCAGATGTTCCGCACACCATGAAGGATACATACAAAGGCCAAGATAT
CGCGACATACCATACAAAGTCCAAGTGATCCGCTGGATATCCTTGGAAATCAGATCACGCGCATTCCCCCACGAGTCATGGCGCTGCCCCGCGGCGACGA
CGGCGACGCGGAGCTGCAGCAGCTCAAGCAGAAGCTGGATCCGCTGGTGTTCGGACGCGATGTCGTGTCTCTGGACGAGCGCCTGGTGCCGCGCGGGCCA
GAGACCACGGGCTTCGAAGTGGAGCCGCCCAACAGCAGCTCTTTCTACGGGGCGCTACCTGCCGACGCGGAGGATGAGGACGATGAGGACGACGACGTGG
AGAGCCTCGAGGCGCCCGTGAACCGCTACGCCGGCGTCATCTACGCCGCGCGCTTCTTCGTGACGCGCGTGGGCTTCCTGCGCTCGGCCAAGCGGCTAAT
GGTGCTCAGCAGCAGCCATTTGACGGTCGTGGACCCGTACTCGGACGAGGTGAAGGAACGTTACGCATTCGACAACATCAAGGAGATCACCATCGCCTCG
GACAGCGGCGGTCACAACGCCGACCGAGCCTTCACCATCTTCATCGGCAAGAACCTCAAGGAGACGTACACGTGTCGGTGCAGGCAGCAGCTGCTGTCCG
CCTACTACCAGCTCAGAGAGCGCGCGTCGTCCTTTAGGAAAGATGAGATCGATGCAGCTACAGCCGACGCTCTGAGTGCCGTGGGCGCCAGTGTCGGGAC
AGGAGACAACAGCTGGGCCACAGGATCCGGAGGACCCGGCGGAGCAGGCGCAGCGAACGCCAATATGCTGGGCAGCGGCATGTACTTTGACAGTTTGTTC
CAGCTGTGTGGCAAGACGTTCACGATGACAAAGCTCAGCACGACGCGCAGCATTGCGATCCACCCAGTGAAGGTGGATGTGCTGCTGGCTGTACGAGCCG
CGAGCTTGGATCGGTTGGACCCGCAGACGCGCACTACGCTGTCCTCGATTCTGCTCATTGATATCGTCAAGATCCAACGGATCAACACCAACTCCAACGA
ATTGGTGCTTTACTTCGAGAACAACCGCGTGCATCGCTACTGGTGTGACAGCCGCGAGCCGTTTATTCAGGCCATTGCGAACAATTTGCGCTCGTGGCTG
AGCGTGTCGCTTTTCGTGGAGGAGGTGTCGGACTCGTGCGAGTTTGACGCACTCACCTCGACGAGGGATATCCCACAGCCTGTCACATTCGAGATTCCTG
TGCTGAAGATCAGCAAGAATAAGTCGGACAAGTTGCAGCTGCGGTTGCTCGGTCTGACCGCGTTGGCGATCATTGAACGTGACCCTGTGACGAGGAAAAC
ACTGGCAAGTCACTCGTTGAACGACATCTTTAACGTGGTGGTTTACCCGTCGGTATCTTCGGCTCAGGATGACCCCGACAGCGAATCATCCGGGGTTGAG
CGGTAAGTTTGCGCTAGAACTGAAGCATGGGCTGACACGTCGGTATCTCTGTCTCAGCTCAACGGTGAGCAGGCGCGATAAGGAGGTGAGTCTTGGATTG
AAGCGAATATCATCGCAGCATGAGGATGAGCTTCGCCAGATCATTGGAGATATCGCTGGAGATGTGAGCGTGCCTGAATGGTTAAATGTTGCTGGATCAA
CGACGTTGCTTAGTCCGAAAGAGGCACGGAGTTTGTTCCTAAGCAACATGATTGAGATGTGTCGAATGAACAAGCTGCACGTTCCGTGGTCGACAGAGGA
GACGAAAATTGCATGCAAGGAAGGAACGTGGGGTACAGAGGTTCACCCTGAATGGGAGGATATTCTGTTGCGCAAGCTGGTCAATCTGAGCTTTATCCCG
AACCTCGTGACGAATGAGAGCATGTCGCTCATCTACTATCAGCTGGTCCAGTTTAATCGCAATATTCCGTTGGGAGGTCTTCGTCAGCGCGATCGTCGTG
CATTTGCGAGTCTGATGAGGCTGCTCGAAAATTTTAAGGACTATTCTGTAGCCCAACTCAACAGCCCTTCCAACACAGATGCACCGATTCCGACAACAGA
GTTCCAGGTGGAGCTGCTATTGGCAATCCAGCGCTTGCTTTGCACTCGAGGTGTCTTTGAGGAAATTCCAAGTTCACAGTACAAGAACAGCATTGAGGTC
ATCATGGAGCTGCTTCATTCTCCGATGGAGGAGGTAAGCTTTGCGGCAGCGTGTGTGATTAAGTACATGGTGGTCAACTACTCCGATACGCGCAGCTTGA
AATCCGAGACGGCCAATCGCCGCGCTATATTCACGAAGTATCACAGCAGAATGTATGTGTCTCGGGCTTTCGATCTGTCCCGGACAAATCGGGTAGGACG
GATGCCCTTGCATTCTGCTTCTTTGGTAAAGACAGGGTCGGGTCATGGATCTCTCACAGTAGCTGCAATGTCCAATACTGAGCGCAGCATGGCTAATGCG
CTTGCGTACTCTCAATTGGGACTAGATTACCTTGTCCTTGCTATGGTACTGCAGACACTGGAAGTTTGTTTATCCAGCGGAAAGAAGGCGACTCCTGAAA
GAGTGGCAAGGGATCTACTTCGAGCCATGAGGGTTGATGACTTTTCTCGCCACCATGCTCTCTTCTTATTCAATCGATCTCTAAGCTTCTCGATCACGAA
GTGCTCCTCAATTTTGGTGAAGGCGCATATTTTGGAGCAGCCCACTGAGCTCGTCGAGCTGATTCAGGATTTTGCACGGAAGCACGGGGCGCTCGTGTGG
CAACTTTACTTGGCACTGTATACCCAAGACAAGGCACAGCGGCGGATTTCGTCCCAGCTTGTGGCTTTGCTCACACATGAAAACCCGCGTTCATCTTATG
TGGTTCGGAATATTTTTCCACACGCGTTGTTGGATGACCTGAAGACCAGCCAACTAGAGTACGACGAATACGGCAGACATCTTCCGACCGCAAACCCTGA
GCTTTACGCGAAAACCAACGGTGGTTCGCATAAAAATGGGGGCCGGCGTGATATCACCAATGCAACGGAGAGTGGGCGAAGCAAGCTGAGCTACGGGATC
AACACGCGAGGTCGCTTGGCCCGAAACGTTAAGTATGCCGTGCTCTTACCAGAATTCTTTGACCGTCTGGGTAAAACCTTTGCGACCAAGGATCTTGTGT
GGGCCCTAACGCGGTCGAAGAACTGATTCGCAAGCTGCAGGCAGAAATGAGTGATCTGGACTTGTATCGACTGAAGTACTTGGGGTATCTTTACACGGAC
CCGCTTGCGACTGATCACACGGAGACTGAATGGGATGCGTTCCAAGCAAATCGGCTTCGCCACAACGATCAGCAACACGCCAATTTTGCTCCGTTTCTTT
TTGAGTTTTTGCAGAACGGTTCCGAAAGTCGACTGGCGATTGAAATGTTGAAGGGAACGATATCGTCATCCAATCGATTCGCGCGGTTCATGCCTCTGTC
GTTCCTGCTAAACCCTGACACGTCAGGCGACGTCGAAAGTGACGGCGGACTGGATGATGACAATTACGACAGTGACGACAACTACACGGAAGATAACGGG
TTCGTATCTCGCTCAAACAGTATCGTACGCACCGGAGATAACCCGGAGACCAAGCAAGACGACCACGATGGATCTCACGACGAGTATAGAAATACCACCT
TGGCCAAGAAGAAAAAGAAAAATGCGAAGAATATGCCACGGTGGTTTGTAGCTTGGAATTGCAACGAATTCCGCGTGGACTACGAGTGCCTGGAGAGCGA
GGTGAAGGTTGGCCCGTATTACCTTGCAAACATTCTTGACGATCGTGGCGTGCTGGTAGAAGATATCGAAGGTGCAGAGAAATTCATGACGCTGCTGTAT
TATCGTCTTCTTGCCGAAGACCGTAGCATTTCACCCAAAAGCTTCAAAACGGGTATTCTTCGTCGGATTCGCTGGGCGACGTCGACCAGTTTGATATTCG
TTTGCTAGTTCTCAAGGTCATGATTCAGCTGTATGAGCGTCATTTCAACGAGTTGGGCTCTCTGATGTTCCTAAACCATTTTCTCCGTGCCAGTATGATG
AAAAGCCGAGATGGTGAGGATCGACGTTGGCCGTTAGTGGTCCGTGGCAATATCATGCTTTTCCTGGATCGCGTGTTGTCGAGTGCATTGAATGTGTCGC
GCTTCTTACGTGAAGGCAACAACGTAACAATGGTATTGGATTTGCTTCGTGAAGTGAAGCCGCTGGTGGTTCTTCAAGGACCAAACGATTCTGAAAAGGA
GTATATCGTTGAGCCTGCTGCTGATGTTCAAGCAGAACTTGATGCGTCTGAAGATGAGAACGAAGCTATCGATGATGAAGACGATGACGAGTACGGTGGT
GACAGAGGTGAGTACGACGACGACGACGACGACGACTACGACGACGACCGGGATATGGCGAAGAGAACGATTGATGCGCTGGAAGAGTCAGGTGCTGAAA
GCTCTATTATTTCGAGCCATTCTATCTCGCCAACTTATGCACACCGCGATGACGAAAGCGTCCACGAGGAAGAGCCCACTCGCGTGACAGTCGTGGCAGA
GCATTGTGGTGCCATGAGTGGGTCGATGATTATGCAGACCTGTTTGAGCGTGCTCAGTCGCCTCATCGATTGCCATACCGCCGAAGAAGAAGGGCACATG
CACCAGGATGTGCGTTTCCCCAAATACGGGCGGCTTACGCACTTTGAAGGTTCGGGTGTGAGTCCAATTAGTTCTATCAAGCACCGGCTGTGTGAAGATC
AGACGCTGCGGTTCTTGGTGGGACTCTTGGATTGTCCGAATCGCATTGTTTTCAAGAAGTGCCTCGGATTGATTCGACTTCTTGTTAGGCACAACGAGGC
AATCATTCCGAACCTACACGCATCCGGCATCTTTTACTATCTGCTTCGCTTTGCCCAGGATGTGGACGAAATGTCGATTGCGGCGCGTCTTATTTCCCAT
ATCCATCTGCGCCAGTCAGGGCTTGATGTGCCTCACCTGATCGATGACAAGCAAAAAGGAGAAAACAAGAAGGGCGTTTTCTCTCCTGATCCATTAACAC
GGATCTGCTTGAGAAGTTGGCTGGTACGAGTGCTGCCAGTTTCGATGGTTGCTCAGCTGCTCCGTCATGGACCACGACGGTTTGCCACTGCTCTTTTCTC
GGACGCAAACAACCCAGAAGTGGTCTGGAATGCAAACATGCGCAACCAAATGGTTTCCTATATTGAAAAGTTTATGGAACGTCATACAGATGAGAACGGC
ATGTTCTACATCTCAGAAAATGAGGGCTCGGAACACAAGGCCTGCATCGCGCTGATCCAGTACCCGAAAGAAGTTCACGCATTGCAGTGCTACCAATACT
ACCTGCACAATCTTCTTGATGAGAAGAATTTCCCTGGGTGGCCGATCAACGACGAGGCTGCATTCTTGCGCGCTCTGCTGGATTCCATTCGCCGCTGGGT
GCACCCAGGGCTACTATTGACTGCTCGTGGGGCGATGGCAACCGACGGTCAGTCCACGAAGCTCCTTTCAGTGTTCGATGCGGTAGAGCTGCTCGACGCC
ACAGCACTGCTTCTACGCCGTTTCCCAGACTCGCCAAGTATTACCAACTTGCGCAACTTCTCTTACTTCCTGGAAGCCCTGGAACGATGCATCACAGAGT
TGAAAGACAACCGCGTTGGCCCGACGAAGACGTTTTTCGACGTGTCCAATGCTATATCAACAAAGGCTACCTTCGTTAAGGCTTTTGGAAGTGCGATTCG
TGTGATCAATTTGGCCGTTGGAATTTCGGACGAGAACGCTCACGAATGTAGCTCCGGGTTGGGGCTTCGCGTGCTGTGCAACTCACTTCAGTTGCTCTTC
CACAACCAAGAAGCGCTGAGTACTATCGATGGTTGTACGCCAAATGTGATGACACACTGGGTGCTTGAAGCACTCGTGAATGTGTTGAACCAACCTAATG
GTCGAGTATCGGCCGCTGCACAGTCAATCGATTTGCTACCGTGTCTGACACGCTTCCTCTCGCAAGGAGGCGACCGTCTGGCCACGGATTTGTCCCTGCA
AATTGTGTACGAAATGGCTGGAAGCTCGGGCGAAATGGCAGAGGTTCTGCTACTGCAGCTCGCGGAGCACGGAATCCTGTGGTATTTAACGCTTCTGTTG
TTTAACTACCAACCGAACAATGAAGATAGCGACGGAGACATGCAACGCATCAGCATTGGTGCAGCGAAGGCATTGGGGCGAATCCTGGAAGCCAACGCGA
AAGAGGAATCAATTTCTGTGTTTGTCAAGAGAATGCAGACTACGATCGAGCAGGTCTTTACACGCCCATTAGTGGACATCTTGCGACGAGCGGGGCCGGT
TAAAATGTTGGACGTGCTGGCAACTGAAGTTCGCGAGCCGCACGTGATGTGGACTGAACGCATGCGCAAGGAGCTGATCAGTCTCGCTCAGCGTGCGATC
CAGTTCCATACAACACTGGATCAGAGCGATGAGGAGGTGCACAAGGTGTTTGAACTGCCAACGTATTTCATGTACACGGCACAGAAAGAAGAATTGTGTG
TGGCTGGCATCTACGTCAACTTTTTCAACGAGAACCCGAAGAACGGTATCCTCGCCCAGATTGCAGGAACTGTGAATGGCAATGGAAATCGTGCCGACAT
GTTTAAACCCAAGCCGACGAC