Description :
From Genome Similarity Track
Location :
Scaffold_374:10247- 12207
Sequence
1960 bases(100 bases per row)
CTTTGCTGGCCTGCCGCCAAGCAGGTAGTATTTCTGAACCTGGTATCGCCATCGTCTTGGGTCTCGGTTTCTCCTCTTGGTACTACCTACCGGAATGGCC
GCTTCTAAAGTGGATCTAGGATCCCACCCATGTACCAAGTAAAATGGGGTATCGCCCCGGATCCTGTCCTGTGCGGTATTCATTGCGAAGGTGAGTCGCT
CTGCGTACTTATCCCAATCCCGCTGATCCAAATCCTGAACATACATCTTAAGCACCCTTGTGATCGTTTGTACCATACGTTCGGCCGATTCATTGGCTTG
GGGATGATGTGCCATTGTAGCTTGCTGTCTCTGGTCCAGGATCCGGCTGAAGGCTCGAAAGAAATCAGACATGAACCCGGGCTCCCGATCGTGACGAATC
ATCTCACTAGCCCCAAATCTACGAAAGACACACTCCTCGTACGATTCGGCGATGGTGTAGGCAGTTCCGGACGCGCTAGCCTTGGCTATTACGTATCCGG
TGAACAGATCCACCCATATCAACAACTCGGTGCTTCCTTTGAATGACTTGGGTAGCGAGGGGATGTGATCCATGGCTATGATTTGGAACGGGTAAGTCGC
TTGGACATTCCTAGGTGACCCCCCTTCGATTGTGGGCCTGCCTTTGCCTATCTCACAATCCACGCATTCACCGACATATCGCTGCACACCCTTGAATAGT
CCCCTCCAGTGGAAATATTCCCGGATCCGTTAGTAGGTCCGACCAATTCCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGACATCCTGTT
GTAAGGGCTTCCCGCATCACCAATCTCATCAATCCATCCCGATCCTCGTTGACCCTTTTCGTAGAGAGACAATAGAAGAGCAAATCATTCAGGACTACTG
CATAATCCGTAGCGATAATACTGTAGGATTTGGCATCCTCCCGACTCAGGATCTCGTACATCCCCCATCAGAAGTCCCAAGATCCACGCTTCTTCGTTCT
GTGCTCTGAGGATCCGCTCGATGCAGACTCCCTTCACAAACGCTTCCTCTAGGATCTTGGGGCTGGATCCAACCTTTCCTCTGGATCTAGTGACATCCAT
AGCCTGGACCGTCCGCTTCACGGATCCAACCACCATAACTTCGTCTAGTCGGTTTAGTGTGACGAGACCCTGACGCTCGGCCTCTCTCTCCACCTCAACC
CCACATTGATTCCGTAAAGCAGCACTGGCCAAACTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACACAGGT
GGACCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATTCCCACAAATCAC
CAGCCTTTTCGGATCATGTCCCTTTAGTAGATCCAAACCCAGCAGGAGTCCGCTATACTCCGCTTCATTGACGGTGAGGCCCTCCGCACAAGTGGATCTG
GCCCTTACCGCTTCCCATCCGGGCAATTTCCACAGTATGGCGCTGTATGCTCCTCCTCCGCGTCGTATGCGAGCGGATCCATCGAAACTCAGGACGTACA
GATCCTTATCCACTCGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCGTCCATCTTGGCTCT
AGGTGTGATACTCGCGGCCAAAACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGGGAGAGTAGCGCTGCCCATTGT
CCCAACCGTCCTTGTAGACCGGCCGACTTGAACAGCCAAGCGAGCGTAGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTTTTA