Description :
From Genome Similarity Track
Location :
Scaffold_38:102460- 112866
Transcript NameFunction/comments
Phyca_LT153418575cellulose 1,4-beta-cellobiosidase

Sequence
10406 bases(100 bases per row)
acgatcttcacatctgccagaggctccgagctcagatacacgacgtaggaatcgttcacgccaccttcagccacctgcagctgcttcgcctcgcctcgga
gcaagacgttcacgtgcgacacgtcgttgtcggtgatcgacaccgtcacgtccatcttgtagtcgctcacagtgtacaaaggatcagagctcacggacga
gtgcgagattcgagccgagtgaacgtccgcctcgtccagccagtcgtccacggcaacgaacgacacgttctgccacacgctccagttgctcgctccgaaa
tacagggacgttgattcactcgccagactcgtattgcagacgcgttcgctctcaagacgcatgtagcactcgttgctcgcgtttggatagacaaccacgg
gctcccacggctccgacgtcaatcggatgctgtacgagagcgtcgttgtgttgctttccaccgcggacatctctctcgtcgacaattcgatgccagactt
gtcgttatccgcgattaagaccttcacggaagctaaatcctgtagtcccgcgtagatgaggtcgtccgttgctagtgagtggtccagatggctaaaggag
cccacgacgtcttccgtgtcgtcgttagtcgccgtcaccgtcacaacctgcgcgatattccagtccttccacgtgaaattcagctttgaaggactcggga
cggcgaaattacccactgtcccgacgttcgtcacagatacagtcacgttggcgaacggctccgacgtcaacacgaccgtgtacgcgtccgtcgcgccgcc
ttccatgacgttcacgctcactttgttgactacgaacccagacacgtcgttatcgcgcactgtcacgtccaccttggcgatgtcaagcattgcattgtac
ttcaggtcggcactgtacgaagtgtgcgagatcccagtcgggtgcgtgtcgtattcgtccaggtcgtcgtctgtagctagcacctccactttctgctcga
tgttccagttccgaggcgtgaacacgaactcagaaaccggcagcgtcacgttgcacagaccaaaacgatagcactccgtatgattcccgtcgagccacgg
gagaaccacgatcttcacatctgccagaggctccgtgctcagctttaagttgtagtgagctttgctcgtcccgtcctcactcactagaagtgtagattct
gatactaatacttttgcgacatcgtcgctttctacttgaaccgttacgtcaggaagagcaagggtcgagtaggtgtggtcatcgctgagaaccttatgcg
ccaccgttgagactgtcaccgaagcgtttgctgcggaatactcatccagatagtcatctaccgcctcaagtcttacttgttgggggatacaccagttctc
aggcgtgaaaacaatccgcgggttcaaaacggtgtagttacataggagtcgctcttgggtcgtctcactcacaatagcatacacacagtggccacgaaga
ccgagagggtcagttaaatctggttggaaaatggcactggtgatggctgagcacctcgacttgccttgtaaatcgcgctccgaaggaactggtagcgggt
caatctcctgtgtgatacgggacacatcaacggtgattctcaggtcggcgaagcgcatggagtcctgtagcgcccactctagcctccacatgtggcctcc
gtccagaaatggtccttcccgatacacacgcacgcctgcatcgaactcaagtcctcgccagcctttcgtctcggggtcgtactccttttcccggttcgaa
cgaacgaaaggtaaagcctccagtgcttcgtccattccaatggcagatacattgataggaagccaccacgttgtgtcaatatatgcttgaccggtgtctg
ggtccaatagttccagcttcaaattaaaaacaccacccagatacgtgccattagcaaccgtagtagtagtgaggcttagcccaggagcttgtgccataat
tggatcagggtaaacagcgatcggagggagattccctgggctgttgaggtagcttatgacccaattgtaaccattgcaaacgctaaaaggatcgcagtcc
actccgaggcgtgttacatttgtcttctccgtgatctcaagggcaaaaagcgcttcctgaactctcgaatgcgacgcatcaaatggcaacaatgtggtgt
ttttcaacgggagatccaccatgtacgcgcttcctgtacgtgggtcaatcttcttaaaccagcctcccatttggaccatcaagttcccacgcagagcttc
tccgtctcgaatagtagtcactccaactgtgacacctctacccgttagattcagagacgttgcaagcaggctgggtaaatccccatagttctggaggaac
tgaaccgtccacgccattcctccttccgcagacaacttctcgcaagacaccgtcacgctcgctaagcctcgcagctgtcctaacttagcggcaagtgtct
ctgccgaatcattccaaaagatgggggcactacggttgggctttgtcgaggtgatgttaagaggggtagcatattcaatcacaaaagcaccattgatcag
tactggtgactgcgtctccgtcgttgtgatggccacttgactcatggcgtttgccaccataatagatgtagagttgacgacgagattggaaaaggtctcg
acactcacgaaagtgacgatgtactcgaacccgtagccttccttacccagtgatctccttgataccgccacggaatgtatccctgcttgtgagcttagag
tattttgaagagcttccgctgtcggtagcactgctagtgagaatgtagctgccccataactcagtttgaacgttccagttggagaaatactcgtttgact
gcgtcggcagattacttcaccttgaataacgccattaaccgacacagaaagcagcggaaaagtcccatccgaagtcacaaatcgtaggaatgtcacgctc
cacgtcaacgtcgaagctgcatactgaatggttcgattcacactgacagcgtttgttccaccgggaaataactcattgatcgccgcttgtacctgcaccg
ccgtagcgaatagatcaagacttgaagtggtggagccatcaccatttgtcagggtaaaggctctgccgtaacttgtagcggaagcgatagcctcagcaga
cgcaaaacgcgacttaaaatcatcgtcgaacgtgaaaacgatcgcttgaatctcaaagctgaaccccccagacacggaaagcaggaaaacctgatcaacg
tggtccgcatgcgtcacaattcgttgcacttcagtgattttgtccatcctcaaggagatctggtgaatctctcgagtcgaaatcgtgcttaaatgaacta
aactgacgctttgatgacgaggtacgccacacgacgttccgtcaaaggggtaaccacatcgtcgatagcacgcttcgtctgcctcgttactcatcgaaat
cgcgacatcagcgtagggttctgtcagcagttgaagtgtgtaggaatccgagtgaggatactgcagcgctgaagctgctacgttcttctcagagagagaa
acaagcttggtcgaataggtaatatccgtgtcgtcattatctgcgatggcaacgacaatgtctggcaccattagagcatcaaaagaggaatcggaactct
ccgttgttatctgaataattgccaagtggatatcttcctcgtcgagatggtcgtccactgcaacaactcgtactgttctcggaaacccccagtcatccgt
agtgaaaatgaggatgtctggggatactgtgatgttacacagtaatttactcgtccccatgctcttactttcatctccacacgtgagaaacgagtcgtct
ccagccactgcaaatttcccattcgagagcacaactgtgtgcgaagggcacaaaggcttttcccgacacgaacgataacacccagaggcaatgtccagtg
tcacacgaacctcctgcgttggcttggagagtaaaatcacctgatagtcattgccttttccatcttccgatacactcaacgatgttgtcgaaatatctac
acccggtgcagttaagtccgtaagacccaccgtcaccgacgccactgagatagccccggtatacgtattaacagatacgatattttgctctagtgactgg
gaagcccacgacaatcgaagatccatcagggcgtcttggcgtgtgatttgttcatcaatcagttcaagaattcggtagacaacaaaatcgctgtaaaatg
cccccaccgactcctcaactttagataaaagttctccacttgttatactgaaagtactcgccttcttggtcaattgatacagtggtggactggatacagc
gtgagaaacatccgctgagtgtaaaccttcgtacagttggtcattcgtagccagaacatgcacaagttgcggtaaattccaattttcactcgaaaacacc
agtacagacgggatgagtgatacatcgcacaggttgaagcgatggcaggtgctctccgcgacgagattcacggtcacaggctgcaacggcttggcagata
gtgcgatagagtacgtgttgtgggctgcagtggattccgtagagaccccgtccaagaaatcgtgaaagtgatctaggatctctgtagttactagcggccg
aaggaaccacgaaacacacgctaccttcccagtgaacccaccccggaagcggataactttctgtgacaaattcggcaacgccatgctgcaagacgtcgag
tttgtaaagcagttgatgctatgctgttcgcccatgacgcagatggagagcgatatactggacgaagcacggtcatatatcgccacagcctggtgccaag
cttctgcgaagggtaaagcttcggcgtctacacccagctccgatctgcagcccaccccgttctccgggctggccattttcaagtaaaatcttcctgtctc
gctactaaaccccaccattccaaacgttatttggtcaccgcctgtatcttttccataaaaggtggcaatttccaccgagtcgatggagttctgcttgatt
tggaaccagaactccagagagaacgagctcatagccgtttggattgtcattgtagacgagaaaaaggtgctttccaagtgatcactgatgctcaaatcca
ctggcgttgaagcaggtttgatctccaaagcgcctgtcgctctgttcttcccaccccacgaagctttgctttcgccattgctaaccagtaccttgggggc
atcgtcgaacggccatatgacgacagggttcgcccgaagcagtagtgcgcgattctcattcactgataacggaagccggttcaccggtagtagctcggat
ttcgcgaggacaacgagatcaatgaagtcacttagcaccaaagtgtcaacgtgcagaggggattggcagcttgcatcacaaacatagttcttgcactgag
aacttgaagatgccacaacgccagctgcgtctagattgcacagcgaagaggtatccgttaaagcttgcgttgcagctccactccgaatcccagtgagctc
ggaaccatgggtagcaacggagaattcagccacagcctccacgttcgtaaccgaacaggaatctacttgtgtttggacttcaattagtccaatttccact
ggcacttggaactccagaactagccactcgtgataagaaggagcgctagcaacgtagcaatcagtcttgtcctttacgtttgacagcgcactggctgagt
ctccaacctgggagctcacactgtggatttcataactcaaaggagccgagacagtttcgggattcgatggcgctacatcactcggagggaagacttgtat
actagacaacgctaggggcttctcgccagtcccaaacaagtccagcagcaggtaacgcgattgaatagctgggttccagcgtagaacttcgacctcgttc
agcattaaaactccagtaccacgtcttcgtacagtcacgaagcgagctttggagaggatattctcccacgcaatcgagttcgtgtaactcgcacacgaga
acgacagtgtcttactgatcgtgacagaagctgtagacgcagttccgtcgcttgttgttagcgattcatcggacaaaagcacgtcaaactgctgagaaaa
tggggctttcagctgtagcaaagagtccgtgtaactgtcatcgtacaaatccccactccacgatggaaacctgctggttccgacccctgcacaggcctcc
tcgtacagattcccaacgtaaggataaagaatgacggaacggacaggctgcactctgcccaggtcaacttcccaccacggattcgtttccatttccgttc
gcgtactacgagccgccatagttttatcgtctttacttcggatgataagggggtcccatccagtacgttgcaaaccgtctacagccaaataagccaacgc
gtcgcttggctcagtactgctctgcctcgtagccattccgagcgccaagttttcattcttcgatctccttacagtctgaaggagacgccacgactgcaac
agaactggacttgggtcccaatctgatttgagtcgggaacggatcccagttccatctgctgtcggagtcactgttaaaaagggttcaaaagcttgaacct
gtgccaattgcagaattccgacaccttggcggtaaattctcaccgctactgcaccagcttggacgtcccagagtaaaattcccttacgaactgacagata
ttccactttaggacacgcattcggacagccattggccagcgcgtcgtctagagtaagtacttgggaggcaaatggcttcagagaagcaatcacgataatg
ttgaagacgtctggggcatctttaaccagtgaagcgggcaggaaaattactatcgtccccagttttgtcagttgaggaagaagtacttcccaccacggat
ccttttcacttgtagttgtagccaccatagctgtaccgcgtgaatcatcaaactgagctccgttcgtagcaagggaagcttcgagtagctttgtagacac
ggaatccactgccgttgagctctgagaggctgctagatcacttaggatattcgagaatgtgtaggaaagagtcatcagtgggcgtaggttcctctcaaac
accgaagagcacaactgtgtcatagcaataggctcgatactcccttcctcgggcagcgcttggatcttcagcgaaactacggacaatcgagtcggtatta
tctgcgccagcagtgacgaaatatccacttcaattgagcggcttttctccacagttgcagtgatcttaatggacgcctcatccaggaaagaaagagcttg
agggactgttccttctcgaatacttctacttgtccaggagttggtcacggctgtcacttttaacacatatttcctcgtatactccatctcagttgctgaa
ctgtcgctatcaaggtcagacgcgtcgaaggtttcgtacggggtttgatggagcactaacatagcctttgaatatttgagagacgtgtccccttcgtgca
aatgcggcagatggaacttcatatacgtcaccacatcggcacccaacatgagaatgttatgcagtgttgcctcggtcttaccacttgacacagacacatc
gtggaatgccagcgctgtgacatagtcacccacccaattcgttgtatccctggcttctttcgttgccaacgtcgcttttggttggttaactaccacatta
acctcggcgacgtcattatccctcacggaaacagtcaccagtttgtgagctggcgaatggaaaactgtgggcaatgcgttataaggggttagaccacaat
cccaagctgggtacagctcacttgccctcgtgtttgtgcctcggaaccagaaagcagtggatttagtatatccaaacaacgtattttgtactcgatgaga
aattgtgaagctcacgtcaacttcagccaccgcatcatccactgctcgcaccacaacacgctgtggtttgaaccagttcgtggctgtgaaggttaaaagc
gacggagaaatcgcgagttgcgagttcccttcaatcgcaatactcacgttcggagcgtccttcgagctccatgctgactggtcgtagatcgtcgcagcta
cagcttcaaaatcgctccagaacccgcacatatccgattgtttatccttgcaatacgctgaagatgcgtgcaattcgctcgtactgacgatcgttgcgct
gcctatcgaaggcggggcgtttaaaaccacatcgtatgctgcgccagtggggtctccttcagtgacttccaagtccgcactagaaagcgtgactccaggg
tcattttcccagatactcacgtcggttgtactgccaggaaggaagttcgccattccgcagttccacgaatgtcgctccagtgaatatttcgtagggaaca
tcgcgaaagtggcagccaagacacgacttacatatcccgcgggccattcactatatgcccaacgcatcgtttctagtcgtgccaagcctgcgcaaagtgt
atgctggacattcattgggttcttactcatttcccgggcttgttcaacgttcatcagtcccagaaaactaagtacaaagcccctcaactccggcgggggc
ggaacgaaatccgaatcagataaagtctgttcatctgaaagactagaatcgcttttctcggctgtcagcacttcaattagcgtcgtgtagctcagatatg
ctggggtttcactgctttcagggtctaatggtggatttccgaagcgctttaagacatttccacgtaccacattggcaatgcacgctccattaccttgtgc
aaaggcacagtcgtttgttaaatcacacactcgaacaacggtttgtccagttttcagctcctccttcggcagtaaacagactgcagagttatcggggtca
caattcagtacgtcgaagcattgagggcggcgcgtatggtaccgaatatccttactctcagtgtagtgaagtaacgggcctccactatgcagtccaccga
actccacttcggaatcagtgtcgtccacggcactaaccacaacgtactgagggttattccagtcgacaggttgaaacgtcagctctaatgtgtatcctcc
ttttacacctggtgcctcggaggatatcgcagtttgattagcgtggagagcttgaacaactaccttgaccggatgccatggacgagacgtcagtacgatc
ttgtagctgtccttaccgcctccttcggccacaaatacatgttgccttgataaagatacgccagctacatcattgtcatcgatctgtatagtcacagttc
gtccagcgaggaacggcgtgtcttcgctattaaaattcgggtcggagctcgatacagtgtgagtcacaacggcgtagtgccttccttctgccagatcgtc
atccactgcggttaactgcacgagctgctcttgattccagttctcagatgtgaacaccacgcgctgtgaggtcaagaacttgagttgttgaactggttcc
tcgcttggatccagcaaacgaacatctttagcttcgactacgacgtcagtgacgggttggcggttcaagaccacagcatattctgccaccagtcctcctt
ctgtgattgtgttccttctcggtgtcaacgtcactcctccgtccatcgtaaaatccataatatctccatcgaaactcaaactcacagcgaaatcatacgc
tcggttggaatcactcgtgacgcatccacctgaaagcagcagcgtattgaaacttccatccagcctcaccccatcggcaacgtcgttagcagtcgtgcca
aactgacgtgtccaaagcttctctccctgtagcgaaagtttaagtagcacaacatctcgacctccgtattgcccgaagccgttgagaacgtggccccctt
catccagatagccccatgtgtaccctgtaacgtagagaaactcggtggcatcagcgtccttgataatggtgatagaagtggctgcatctgcttggtccgt
cccccactggagataaccacctcaacagtaagtaaaacccgtacaaagatcttctaaatccagagttttctacctctttggtccagtcgagagttccatc
ggcgtccactcgagctacaaaaatgttgagaagggcggacttcgagctgtcgagggtcttggagcctgcgaagtaccatttgccagtcgtatccttcgaa
ccgccggttatatcaacggtagcacctgcctgctgtttccagtcgaagtctttgtgcgcgtctatccactgctgagcctcctcctccggggtcaggtcta
ctgcgc