Description :
From Genome Similarity Track
Location :
Scaffold_46:102449- 103674
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_22238Hypothetical protein
Sappa_CBS223.65SPRG_20774Hypothetical protein

Sequence
1225 bases(100 bases per row)
AATCGACAGAATTCGTCGTAGCTAACACCGCCGTTGTGGTCGAGCTCGAACCGCCGCAGCAAGCTCTTGATTTCCTATTTGTACAGCATGATGATGATGT
CGTGGGATAGGAATGCAATGGAGAGAGCGAACACTTGGGCTGAGGAAGCTTCCCAAATCCATGTCGAGAAGCGTCGCTTCGAGGGATGGCATGCTGATGG
AGCCCGTCTTATCCGTGTCAAAGAGTTCAAACGGCACGCGGTAGTCGAACTTTCCGTCCAGCGTCTTGGCGCAGCGACGGAGCTCGCCGAGAAGCATGTA
GCAGCCTTTCGCAAAGCCGGGGCTGTCGTACGGCGTGATGAAGCCGTGCTTCATGTTGCGGCGCTCGGCCACGTCCCGCAACGCAGCCAAAAACCGGTCC
GATGACGACGCGTCCATCACCGCCGCAATCCGCACCCGTGTGCTGGACCAAGTACACAAAATCCTACAGAGACGTGGCGTTGGGATGCAATCGCTTACGA
GCGGTACACGCACTTTAATGTCAATGCACGGGATGCTTGCTTCGGTCCGCGAGCTCCGAGAGATGGTTGTGCAACGCGGGCAGCGACGCAGACCCTGTCC
CGAGACTGTTGAGGCGGTTGTAGACCGGGTCAATGTCTGTCGTCGGGTGCGGCCCCACGAGCTTCTTGCCCGCCAGCAGCAGCGACGAGCTACCTCAAAT
GACCGCCTGGTCGTGCTGCGAGTAATGAGTTCTTACATTTTCTTTGGATTGTGGTTGACAAAGGCATGGTACGCAGCCTGCGTGATCTGGCCAGGCACAG
CGCCAGGGGGCGGGTTGGGCGAGATGACAATGCATAGCTGGCGGAGCTCGAGCGGGCTCAGCCGCACCTTGTGCTGGCGTAAAATCTAGAGTGCAATGAG
CTTCGGAATTCTTGAAAATAGCGGTAGCACCTTGTCAATCATGGGTACGCGGAGGATATTGTCATGTGACTTGATGCGCTTCCACGACGCGCTCGAGTCG
ATGTTGCCATCTTTGACGAGCTTGGTGTTTTGATGCTCGATCGCCCAGCCTACACAGGTACAGAGTGTAGGTGCGTCACGAAAGCCATCCGCACCTTGGA
GAACGCTCGCGGCTTGGGCGATGCGTGCGGCCTGCCGCGCCTGGATGTCGCAAACGCCAGTGACAAATTTGAGAAAGTCTGCATAGTCGACAACGCCGTC
CTTGTTGACGTCGAAGCGCGCCATG