Description :
From Genome Similarity Track
Location :
Scaffold_127:102445- 104940
Transcript NameFunction/comments
Phyin_T30-4PITG_19676Putative uncharacterized protein

Sequence
2495 bases(100 bases per row)
NNNNNACCGACAGGCATAACACACTCAAACAAAGCCTTGACCTGACGCTTACCTTGAAAGCCGGACGTCGCTCTGTGTGCTTGAAGTGAAATTTCTGTTC
TGTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATATCAAGTGAACAATGATCCGGTTATGGATCTTCTTGTA
TGCCAAGCGTCGTCTGCACCGTCGCATGAGCATCTTTAACGGTCCGCGCCCCTGTCCCAGACGGTGAACGTGTCTTCCAAAGGTCGCTGAGTATTCCGCG
AACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGT
GACATAGGGCCGTATCCGATACTTGTTGAAAACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACCTGACCGAGGGTTCGT
CGCTTGAACAACTTGGGTGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACTACGGCGAAATCTCTACACCACACAGTGCATCGCAACAAAGAAGA
AATGATGCCAAATTACTTTAATAATTAAACTGGAAGTAACTCTTGAATCCTTACGGTTTTACAACGTTGTCAGCTGGTGACAGGGGCGCGCGCCTCTCGT
TTTTTTCATGTCGAAAACCTGGATGGAGCACAGCGACGCCTTTTACATGCAAAGCACATCTGCATCAACACACTTGTATTACATGTAACCGAGCATGATT
CGCATACAGTGTAGCAGTACTATTGGTTGCAGCTAGCTCTGAATACGTAGGAAAGGTGTTCCGCGACGAGAACTGTGCTCAACAGCTCTAAGGTAGGACA
CTTATCTGAAGCGTTTTGCTCACTGGAAGTCTCGCTGGTGCCGGTCACCGTAGATGCCGTGAGCATGAGCGTCGATTCGAGAGGCGGTGTCTGGCGCGTG
CCTCGATCCAATCACGCCGCTATTACGCGTGCCCTTCAACGTCCACTTTTAAGTCTCAACGGGAACGAACAGCAAAACCAGGGAAGCCAAGCACAACCAT
GCATGCCGTGCCTCGTGACCCTGTAGCCTGAACCACCAGCTTTGCGGTGATTTTTAAGCTACATTTATCTTCACGTGGCAAGTGCTCCAGCTATAGCTTG
CTATGTAGCTTTAAGCAGCTCTCATATACATGTAGGTACTCCAGCAAAAGGCTCAAGCTGTACTGCGACCTCGACAGTCGAGTTGACTAGCATAATGGTG
CCTAACTGATTAGATTTGTAAAGAAGGGCAAATCTCATGATTTATCTTGAAACCACAAGTTCTTCAAAACAACATGTACAGCGGTATTGATCCCTACTCT
TGGAATACCCTCCGACAGTAGTAAAATGTCGGCAAGCAATTGGCATTTTATCTGTGAAAAAATTAAAAGGAATACTTGGACACCCCATGATAGGAATTTG
TTGATTACCGGTGCTATGACTTCTGTATGGAAAATTTCCATTGGAACGTTGCCCTGTCACACTTTCGGAAGAGTCCTCCCTCTCTGCGGAGATTAGAAGG
TTAATCTTCACGTTCGGATACAGTGTGCACTGTGCAGGTCATCTTGCGTTACACATCTCGCGGTCACCAAGTTGTCGGATGCAATGCCAGCAGGTCCATT
CATCTCCACACTCAACGTCGCCTTGGTTTAAAACTTCGGTGAAGCTCATTTCTCGATCTTCCAAGCGCAATGGAGGCTCCTGAGCAAGTCAAGAAGAATT
CGTACGCAGAGGTCAAGTCACCCAATGTGAAGAATGCCATTTCGCTTGGTCAGCGCGAAAATGGTGCTCTGCGTGCCCCTCGTGGCTCCGTGTCTGTGTA
TTCGCTGGAGTTACCTCGCGTGTCTCGGTTCTAGTGCCCGTGTACTTCCATGCACAGGGTACGTGTCTCTTAGATCGCTCGCGTGAGTCCAAGGCTGCTA
GTCGTATCTCTGGTGTGGGCATTAGTCCTGGCGAAATGCGCGTTGGGAGACTGGCGGATGCGTACGTGTATGGTGCACTGTCGATTTTATCAACTTCGCA
GCTAGCATTATCCCAGGTATTCCCTGAGCTAAGTGACGACTTGGTGCGCCCAGATCTGGTCGAGGTTGGCACGGTATTTCCCAAGGAGCAGCAGTACAAC
GATGAAGGCGTGTATGCTGTGCGATTCTGGCGCAATAACCGCAGTCGCGTAGTTGTTGTTGACGGTGAACACACGGAGAAACTGGATGAGTGCCGACACT
CGCCAACCAAAAGAGGGGTAAAAATTAAACGAGTATGCCCAAAAATAGTACTATTCGTCGCCAACGCTTAGAATTTGAGAGCCCGTTGTCGACGAAAAGT
GGCTACATTATACAAATAGCCATCAGAGAAACTCGAGCTACTGGGGCAGCATGCGCCCAAGCTTTCCTCCATCAGGCTACGCAATTGTGTCTCTT