Description :
From Genome Similarity Track
Location :
Scaffold_127:102442- 103862
Sequence
1420 bases(100 bases per row)
NNNNNNNNACCGACAGGCATAACACACTCAAACAAAGCCTTGACCTGACGCTTACCTTGAAAGCCGGACGTCGCTCTGTGTGCTTGAAGTGAAATTTCTG
TTCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATATCAAGTGAACAATGATCCGGTTATGGATCTTCTT
GTATGCCAAGCGTCGTCTGCACCGTCGCATGAGCATCTTTAACGGTCCGCGCCCCTGTCCCAGACGGTGAACGTGTCTTCCAAAGGTCGCTGAGTATTCC
GCGAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTC
AGTGACATAGGGCCGTATCCGATACTTGTTGAAAACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACCTGACCGAGGGTT
CGTCGCTTGAACAACTTGGGTGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACTACGGCGAAATCTCTACACCACACAGTGCATCGCAACAAAGA
AGAAATGATGCCAAATTACTTTAATAATTAAACTGGAAGTAACTCTTGAATCCTTACGGTTTTACAACGTTGTCAGCTGGTGACAGGGGCGCGCGCCTCT
CGTTTTTTTCATGTCGAAAACCTGGATGGAGCACAGCGACGCCTTTTACATGCAAAGCACATCTGCATCAACACACTTGTATTACATGTAACCGAGCATG
ATTCGCATACAGTGTAGCAGTACTATTGGTTGCAGCTAGCTCTGAATACGTAGGAAAGGTGTTCCGCGACGAGAACTGTGCTCAACAGCTCTAAGGTAGG
ACACTTATCTGAAGCGTTTTGCTCACTGGAAGTCTCGCTGGTGCCGGTCACCGTAGATGCCGTGAGCATGAGCGTCGATTCGAGAGGCGGTGTCTGGCGC
GTGCCTCGATCCAATCACGCCGCTATTACGCGTGCCCTTCAACGTCCACTTTTAAGTCTCAACGGGAACGAACAGCAAAACCAGGGAAGCCAAGCACAAC
CATGCATGCCGTGCCTCGTGACCCTGTAGCCTGAACCACCAGCTTTGCGGTGATTTTTAAGCTACATTTATCTTCACGTGGCAAGTGCTCCAGCTATAGC
TTGCTATGTAGCTTTAAGCAGCTCTCATATACATGTAGGTACTCCAGCAAAAGGCTCAAGCTGTACTGCGACCTCGACAGTCGAGTTGACTAGCATAATG
GTGCCTAACTGATTAGATTTGTAAAGAAGGGCAAATCTCATGATTTATCTTGAAACCACAAGTTCTTCAAAACAACATGTACAGCGGTATTGATCCCTAC
TCTTGGAATACCCTCCGACA