Description :
From Genome Similarity Track
Location :
Scaffold_74:102408- 112699
Transcript NameFunction/comments
Phyci_68175Zinc (Zn2 )-Iron (Fe2 ) Permease (ZIP) Family
Phyci_82700hypothetical protein
Phyci_106207hypothetical protein
Phyci_526695Hypothetical protein
Phyci_232681conserved hypothetical protein
Phyci_526663Hypothetical protein
Phyci_232745conserved hypothetical protein

Sequence
10291 bases(100 bases per row)
TTGGTCCGCCGTCGGATAAAGTCATGGTCGCTGTTAGAGACGCGGCACGACAAGCCACTCGGCGATTTCCTCCTCCGCGCCCAAGTGTCGACCAGCGCGA
TGGACCCTGTAGACGAATTCAAACTGGCGGCGGCGCTCTTCATCTGGGCGCTGGCGCTCGTGGGCGGCATTGCGCCGCTGCTGAGCAGCCAGCGCGTGAG
CAAGCGCGCCAGCAGCGTGCTCAACATGGTGGCGGCGGGCATCTTCCTGGCCAGCTCGTGCATGCACCTGCTGCCGGACGCGCAGAACAACGCGGCGCTC
ACCGAGTGGGGCTGCGAGCACACGGCCGAGGTCTTCCTGGCCGTGCGCACGCGCTACGACGGCGACAGCAAACGCTGTTTCAAGTGGGCCAACTTCTTCT
ACGGCTGCGGCTTCCTCATGGTGCTGCTCATCGAGGTGCTCGCGCACGCGCTGCAGCGGCACTACGGCAAAGTGCATGGACACGGGCACGCGCACGGCAC
AGAGCAGGAGCGGGACGCGCTGCTCGCCATTGAGATCACGCGTGCCGCTGAAGTGAACACCCTGCCCAAGGCGAACGGCCACTCGCATGGCCACAACAAT
GGCCACTCGCACGGCCAGGTCGAGACGGGAGCGTACGGCACCCAGGGCGAAGCGACGGAGCTGACGGTGCACGGCGAAGCCGACAAGGAAGAGCCGCACT
CGCACATCCACGGCATCGTCAAGGGCAACCCCATTCTGGCGCTGGTGGTGTTCATCGCTCTGTCCTTCCACTCGGTGATGGAAGGCATGGGCATGGGCGC
TTCGAGCACGCCTGCGTGGGACATTCTCGTTGCCATCTTGGCGCACAAATCGCTGGCGGCCTTCGCGCTGGCGCTCGAGTTCCTGCACCACAACGTCTCG
CGGAAGCAGCTGCTCTCGTCGGTGGCCGTCTTCTCGCTCATGACGCCGACAGGAATCCTGTTCGGCCGGCTGCTGGTAGATACGAACAACGCGACGCCTG
CGGGCGGTGTGTGCGCCGCGTTCGCTGGCGGCACCTTCCTGTTCGTCGCCATCATGGAGATCATCCCGCAGGAGCTGCAGGACCCGCGGTACCAGTTGGA
GAAGTGCTCTGCTCTGCTCGCGGGCTACGGCGCCATGGGTATGCTCTCCCTCTGGACTTAAACAAACACAACCACTGTTCACTATTGTATTCTCGAAGAC
AAAAGCTTCGACCATTTCGTAGGGCAATCAAGAGCCCGTAAAGCGACTCGCCTGGTGCGACGGCATTGCAGAAATTCACTGATAACGTTAGTAAAAGAAG
TTAATGAGAGAAAACTTACTGAAGTAGCTAAACCACGCCTCACAATCGCATTCTCTTCTCTCTCGAGCTTGAGCGGGTCTGGAATTCATTGCAACAACTC
CACACCGCAATGCGCTTCTACAGCCACCACCACAGCCAGCAGACACACAGCCGTGCTGCATCTCTCGAAGCTCGCGCCGCCGTCGTCTCTGCTTATCTGC
CGTACTTCTGGAACTCCCACTCGCGGTTGTCCAGCGGGCACACCTGGCGAGTCTTGAGCCACCGCGAGATGCAGTGAAAGTGGAAGGCGTGGTCTGCAGC
AATTCGCAACAGAGGATAATAAAACACAGTAAAAGTTAGATAAATCGCTAGCTATCAACCCAGACCCAAGTCCGCAGCGGCACGTACTGCAGACGCCCCA
GGCCACTGTGCACTCCTCGCTGGTGGCCGACGCCTGGTTGGCCTGGCACTCGATGCACAGGTCCATGATGTGGTTGCGGCAGATGGCGCAGTTGTCCACC
ACGATGTCTGCGCAGCAGATATCAACAATAATAATGAGCGGGAATAATCGCGTGAAAGATCTTGAGCTGGCCGGAGGCGGACGCACCCCAGGACCACAGA
GCCACGGCGTTCCACTTCTTGATCTCAAAGCGTTTCTCCTCGCTGGAGGCCGCAGCCGGCGCCACCTCCGCCTTCACCTCCTCGCTCTTCATCTCCTCGT
CCATCGCGACTGCGTGTGCTGTAGCTGCCTCTAGCCCTGGTCGACCGATAGTGAATGGTTTCTTCCCCTTGCGCCAGATATTTCGTACTTAATTGATAAA
TCTCGTTTAGGTACGAAACGATTGTGGTACAGTGTACCGAGGTGTCAGTCATGTTGAAGTGACGCACAAGTTCCTGTTCGTGTGTTCATGCTACGACTGT
GTTCCTACCACGCGACTCACTAGCTCGCCGCTGCGTCCTGCATCCAATGCAGGCGAACTAACTGCTCACCGAGTAGTTCAGCAGCGACGGATCGATCTTC
TGGCCCTTGGAGCGGCGCTTGCCTCGCTTGTTGGACGAGCCCGTCTCGGACGCACGCTGCTGGGCGTCCTGGTGCACCGGGGACTTCTTGCCGCTGTGCT
GCGTCTTCTTCCGCTGGATGAACTCGGTCGCGAACGCCGACACACGCGGCGTCGAGCCCAGGTACGCCGCAAGGTACTCGCGAACCTCGCCTGGGTCCTC
TACTGACGCGCAGTATTCCAGCAGCGTCACGTTGGCGTTGCTGTCGATAGTCTTCAGCTGCTTCAGGGCCCACGTCATAAACTCTGACGACACGTTGTTG
GATCCGAACGCATTCAAAGTGCCCACTTGAGCACTGCTGGACGCTTCCTTTCCGGCGGACTGTGCTGCTCCAAAGTTCCAGAAGGATGCGTCGCTCTCGG
CCTTCGGGGGGAGTGGCTTTGAAGCGCCGTTGGTGGCACGAATCTGCTGGCGGCTCTTCAATACGGATGCAGGCACGGGACCCAATACTGACCGAGACGG
TTTGGGAATCGCGGCAGCAGCAACCTTGTTGCCCGCCACGATGTTCATCCAGTGAGAACTGGTTGGCGCATTCTCGTTGGCCTTTGCCCGTTCCTGAGCC
AGACGCTCTTCTTCGGCCAAAATATCACGCATTGACTTTGAGGTGGTGCTCTTCGGTACAGTGGCGGGAGTGCCCCACGGACTTGCCGCGGGCGCggcag
gagctggggccggagccggggttggtgctggagctggCGTTGGCTTGGCAGCCGGAGCTGGTGGCGTCGGTGCCGCTGCCGGCGCGGCAGGCACAGCTGC
GGAATCCACGCCCAGCATCATTTTCAACTGCGCTCCCATTTGTGCGAGATTGGTCGTGTCAGACTTAGCATCGCCCATCTTGCTGAGCATTTCACGCTGC
TCTTCCTGCTGGATATCCTTGAGCGACTTGGAGTTGTTCGTTGCAGCAGACGCCGGCTTGGTACCCCACGCGTTCGTCTCACTCTTAACAGCCGTCATCT
TCTTTTCGTTCTTTTTGACAGGTGTCAAATCACTCTCACTTTCACCAGCCTTCTTCGCCGACTTCACAGGCGATGCATCGTTGGGCTGTTCTTGCTGCGT
ACTAGTCTGACTGTTAATTTTGTTCGGTGAATCGCGAGCTTCCTGAACAGCACGACGCTTTTCTTCGTTCTGAATATCGTGCAGCGTTGGTGACGGACGC
TCTGGAGACTTCGGCGCAGCTCCCCAGGCATCAACGACGGGAGCAGCAGGGGGGCTTTTAGGGGCAGAGGGCTGGGTGGCCTCCGGTGCCATGGGACTCG
CTGGTCGGCCATGTTGCAATTCACCAAGCGAGCTAGTAGCGTTTTCTAAACCAGACATCTCCGGTGCAGCATTGGGCCAGAACGCCTGGTCACGTCGTTC
GTCGTTGAGGAACATCGCGTTTTGAGCGATAGGCTGCGGGTTCTGTAGGTTTAGCTGATGCTGAGTGCGGTAATCCGACTGGAACTGAATCTGCATCCCA
TCTGAGCGGAAGTTGTCGTTTGCAGCGATGTTGCTCTCTTGATTGCCTCCAAATATGCCCAGTGCGCTCATAATACCTTCGCGCTGGCTTCGTTGCCACG
AACTTTGTTGCTGGAGGAGCATTtgctgttgttgttgctgctgctgttgctgctgctgtcgctgctgctcttgctgatgttgaagcatttgctgctgctg
ATATAACTGCGATTGCTGTTGCTGACGCACAATCTCAAGACGTTGCATCTCCATTCGGATCTTCTCCTCTTGAATCATTCTCTGTTGTTGTTGTTGCTGA
AGCTGCATCATTtgttgctgctgctgttgctgctgctgACGTTGCAACTCTAATAAGCGCTGCTGCTCACTTTGGCGGGGGTCCATATGCATTCCCCCAA
TAGCGTTCATACGCGTTGGTGGGGCTGCGAAAGGCATTTGACCGGGGCCAAATTGACTAGCCAGGGCACCAAAATTGCCCTCGCGACCAAAACGAATCGG
TAGATGCGGCTTGAAGTAACCAGCCTCGAACCATTCACGCATCTCCGCCGTTTTAAACGGACCCTGTTGCAGTCCCTGGGGGTCCAAATAAAACCATTCG
TCCTCCACTTCCAAACGCAACGACGATAGGCCTGGGAATCCTTCGTCAGCAGGCATCTGCGGTAGTGAGAAGCTGCTCTTCTCTTCGAGCACAAGCTGTT
CGCGAGGAGGTTCCAGCGCATCGAACAAGCCTCCTCCACTCGATTGGCGGCCCAGCAGATTTGCCGTGTGGTCTCCCAATGGACCATTCGCGCCGTTTGC
ATTCTGCTCCTCCTCCGGAGTAGAATCATCCCATTGCACTTCTTCATTGTCACTATCTTCGAATTGCCCCGCAGCTGCAGCGTCCTCCAATTTCTTGTCA
AAGGCATCCAAGTCATCTTTCATCTCATCCTGACCGATAAAAAAGCCGCGTCGGCACCGAGCGCAGCATAAGATCAGTTATTGTACGCCGAGAAGCGATC
CGCTGCACACCACGACTTACCGGGTCGATCTTCGGTCCCCGGAGCTCCTCCCTCATTGCATCCATCTCTCGTCGGAACTTCTCTGCAGCCTCTGCCATAC
TTGACAGGTCCTGCTCAGCCACACGCAACACATTAGCCACCACACCACCACCACCTCCGCCCAAGTCTCACGCCACCGCACCATTTCATTGCTATCCGCG
CCGGGCTCCAGCACATCGTCCCACACATCGTCCCCATGAGACGCCTCAGTGATCTTGGCGCCGCGCTCCCACGTCGAGTCCTTCTCGTTGTGTCGGTGGT
GGTCCTCCCTCTGCTGCTTGGCGCCGTCCGCGTCTTCGCCGCGCGCGCCGCGCTCCTGGTGCCCGCGCGAGCCCTGCGCTCCTCCAGAGGACGCGTTGCC
CCGTCCACGGCCGCGGCCGCGATTGCGGTTGAGCGACCACTGCTTGTAGATCTCCTCGTAGTCGAAGGGCAGCGTGCTGACGGGCGGCAGACTGTGCTCC
GAGGCCACCGTCGTGTCCGGCGGGAAGGCGGGCGCCTCGGCCGTTGTGAAGTGCAGCGCCAGCAGCTCCTCCTTGGAGTAGCGCAGCACCTTGCTCTTGC
GGCGCTCGCCGCGGTGGTCGTCGCCGCCCGTGGCCGCGTCTTTGAAGGACGTggggccgcccgcgcccgccgcggccgACGACACGAAGCCCTCGCCGTC
CTTGGACCACTGCGGGCGGTAGGCGGAGCCCTCGGACTCGGTGCGGCCGCGGCCCTTCATGGCGAACATTGTGCGCGGGCGCAGCGAGAtgttgctgctg
ctgttgctgctgttgctgtggctggcgctgctgctgGAGGCGGCGCCGTTGGCGGGGCCCGCGGGCGGCTTCTTGGCCGCGTCGCCCGCCTGCTGCTGCT
GCTGTTTCTTGCGGTGCTTGGTGGTCTTGGTGACGAAGTCGTCGTCATTGCTGGGGCTGCTCATGGCTGCGGCCGTGCGTGTGCGTGCGTCTCGCTCTCT
GTTGTTGCTGGTTGCTCCTCTTTCTTTGGGGTGAGCCCGCGCTGGGGGGAGCCTGTAGGCGGCGGTGCCGCAGACCCGACTAAGTACGAGTTGAAAGATT
TTAGGCTGCAGGAGGTCAGCACCCCTAATTAGGGGTGAACTCGTCTGCGGCATGAGCGGCGCCGGCCTGCGCAACTGGCGGTGCGTGTGCGCGCCCTAGA
GGTCTTCTCGCTGCTGTTCTTGCGTGTCCAGCATTCTTACCGTGTTGTGTTGCATGGGGGGAACGCTCCGCTCGTGACTCCATTGCAGAGGTGAGATCAT
CCAGCCCAAAGCCGCTGCGCCCGATGGTGAAGGCGGTAGAGCGCCGAGTGCTGGCGACTCCCAGCGCGATGCAAGTTCTAGCACAGCCGCAGCGAAGGCT
ACGGGCAGGAATAAGGTGGTAGCATCACCTGAGCGTAAGAAGGTGCTGCGCAAAGACGAGTTCGGTCGCGACGTGGAGGTCGTCGTTGAGGAGAAGGAGA
CGCACCGCAAGACGTCCAAGAGCGAGCGCAAGGAGGACAGGAAGAAGGACCGCAAGCACAAGCACAAACATAAGCACAAAAAGCACGAGCATCGGCGCGA
CAATAGCCGTGAGAGATCCAGGTCGCAGAGTCTGCAGGGCCGGTTGGTCGGCACGCCGCCGCCGCCAGACCCGTTCCGCCCGCAGGTGGGTGTCTGTCGT
TGCAGAGTTGACGGTAGTGGTTCGGTGCTAACAGAGAGGCTTCCTGTTGCGAATCTGTCGTGCAAATAGCTGGATGAAGGTCGGGGCGGGCATCTCCGAC
GGCGTCGCGAGGACAGGAACCGGGAACGCAGTCGAAGTCGGGGCCGTAGCAGACGCAGCAGGAGCCGTTCCCACCATCGCGATCGAAGTCGAACCAGGGG
CTTGAGAAGTCCACACAGCAGTGATCGCCACAGACACCACCATCGGGGCTCTTCCGGGATCCGTAGTAGAAGCCGAGACCGGAACAGAAGTCGAAGCCCG
CCGTCTTCTTCGAGGTTGCGTCGCCGTCGGTCATCGGCCTCTGTTGAGCGTATGTGGACTCATAACGCCTTCGATGATCGCAGTCCGAGTCCACCGCGCG
AGGTTGATCCGTTCTACCGTCCGGAGCCAGAGGCCTGGGTGTCGCGAGCAGGCGGCGTCTACTTGCCTCGCAAATAGCTTCCGGAAGCGTCGCTCGTTCG
AGGTCGTTCACGAGCACTTGGCTGCAAGATGAGTACGCTCCTCCGTGACTGGGATGAAGGTGTGCGAACATGGTTCACAGTACTTCCACTGCGCGTATAC
TTCAAGGTGTTAGACATTTACCCTTTTCTCATCTTTCTCCATTGTCTTAGGCTCGAAGACCAAGCGCAAAAAGCTTCTCGAGTGGTTCTGCAGCCGCTTT
GACCCGACGCATGACGGTGGTTGTCTGCTTGAGAGCGAATGCGGGGCGGATACTGCTCTCTTCCTGCCGCGACTTTTGTCGTGGATGCACAAAACCACTG
CTACTGCCGTCAACAATACTGACATGGGCTGCGCCACGCAAAAATCAGGAAAAGTTAAGTGTTTTGCGCTTGCAGAGCAAGTGGCTTGCCTGCACGTGTT
CTTTGGGTCAACGAACGCGCACGCATACTATCGTGAGTTCCAGCATGCGGGCGGTTTGTGTTTGGTGCTAAAAATCGTGGCCATACAAGGAATTGATTCC
CAGACGCAGAAGCCGCTCGTGTCGACAACAGAACGAGAGACTCTATTTCGTATAATCCTGCGAATCTCCAAGATGAGTCGACAGCGCAAAGAAGAGATAA
GCAGTTTAGACGGCGAGTTGGCTTTGATCCACGGAGTTTTGGCTAGCGGGTATATCGATGATTGGAAAACGGAGTCGCGAGTGTGGACATTGTGTAGGGA
GGTGCTTCTGGAACAACTCGTGGGCAACCCGAACAGCCTAGATCGAAACCATGAGGCGATTGTATTCATGTTGAGGCACTCGGAAGTGCGCCTCCAGCTT
TTTGGAGCCGAGGTACACTGAATTGTTGCTCTCTACTTCTACAGTATATGCTTCACAATGAACTACCAGTCCACTCATTATGCTGTATTTGTAGGTTCTC
CGCGAGTTGATCTCAGACACTTCGTTCTCCTACGACCCGGAGTATCGGCGGCGAAAAGAGTACGATCTTGTACCTCTCTGTCTGACCCTCGTTCGATCGA
CCGATGTTTACCTCCAGCACGAAAGCCTTGAGCTGCTTCATGCCCTTCTGCAGTCACCGCATCTGCAAGTACGTTGAAGTTTACCAGATGGACTTGCACA
TTTTTGGTGGTAAAAGTCAAGTGACTTGGTAACCGTGCAGGGTGCCATCTGCGAAGCGCTCGTGTATTTGGTCGGACAAAGCGCCAAAGCTCTTGATCCG
TACGCTAGCTGGTACTACCGGTAGAATGCTGCCTCTCACTCTCGACTGAAGTGGTTTCGTTTCTGGGTCTTGATTTTTACAGCAGCGTTGAAGAACGCTT
TGCCTCTATCGAAGACAGCATGGAATATGAAACTTACGTTCACCTTCGTTCGGCGTTCGTGCATGCATCTCAAGCCGTCAACACTTTGATGCATTCGAAC
CGTAATTTGTTGCCGATTCTGGTGCGTTGAGTCTTCGGCGCTAATAGCACGTACACCCCATTTTGCTAACTACAGCCGTACAGGTCGACAAGCACGATCT
TCTTACGCCACTGTCGTTCGTACTCGTTGTTGATCGACCTCACTCGCTCAAATGGCATGCCGCAGCCATCAGTATTCACTACATCTTTTCTCACCACTAC
CGGGTAATACAAATGCACACCTCAAACGGCAGCAGCCCGCAATCGACACCACTAACATCTTCGATGTGCCATGCTAGGGGGCAGCTTCGTGTCTAGCGGG
GCTTTTTGACGTCCCAGCGGCAGAACTAATCTTATGGAAAGACAAGCGAGGAGATGACGGAGAGCTGCTCGCCGAGTTCCTCTTGGGGGATGATACGCAC
CAAAGGCATCTCGCGCTACGGTTTTACCAGTGTGGATGGTATCGCGCGCTGTCTCCGAGGAAGCAGTCCGACCAGTCTGGCACCGACCGCATTCTCGACG
ACATCGAGCACAGTGTCGAGACGGCCGCACGAGACGACGTTCCCGAGGTGAGCAAGTCCATACCCCTGAACTCCATTCTCTTTAACCAACGTTTTCCGTC
GACCTTCCTTGATCCTAGCTGCAAGTGCAAATGCGAGTGGGTGAGAATGCCGACGACGAGCTGGAGACCCTGGAGGCGCAGCGCGAGCACCGCCTGCGCA
TCCAGCTTCAGAAGCACTTTGCCCAGTTCCGCCACATCTCAGCCGCAGACAGCAGCATCAAATAAACCTTGAACGGATGCCCCAAAACTAGCAATCTAAG
TGAAATTAATACTACGAGATGGCGTAGGCATAGCCAGCGGCCCACCTTGCTCTCCTCTCCTCTTCAGCTCAAGCTCTCCTCGGGCGTGTAGTGGTCCTCG
AGGAAGCGCGAGAGCGTCTGCAGCTGCTCAGACACGACCTTGACCTTCTCGCGGCAGATTTCCACGTCCTTTTCGGCGCCGTAGGTGCTGCGCGCGAAGG
TGCGGTAGTCCGAGACCAGGTGGATGTGGTTGGCCAGCTCCGTGTGGATCTCCTTGACCAGCTGCAGGAACTCGGTGCAGGCCGCGTTGAAGGCCAGCGA
CGAGCTCTCCTCGGACGACACGCGCGGCGCCATGAGCGCCATGGCGGTGGCCGCCGTGCGCAGCGCCGTCACCAGTTTCTGGGCGAGCGAAGGAGCGAAG
AGGAGGAAAAGGTCAGTCGGCCGGCGGACTTTACGCGCGCGAAACAGCGGCGCCGAATATTTCGGGGCGGTAGACGCACGCACCTTCTCGACGGCGTCCA
GCGCCTGCAGCACCGCCACGTGCCTCGAGCTGGACCACGGGTCGCTCACCTCGGAGAAGTGCACGCGGCTGTCGCCCTCGCCCTCCATGCTGCTCGGCTA
TGCTGTGCGGTGTCGACTGGGCAAAATCGTATTTTGTACTTTCACACAAGCGTAAATAGAATACACTTGTGGAGGAGTGTTTTGCCGGAAATGCGGGTTT
CGGTACACTGTGCCATTGACCTGATATCGACTAACAGTCTGGCTCATGCTGCTCCTCTACACTATCGCCGGCTGCTGCCGTCGCCTTGCGGCCTTGATAT
ACGTGGGACCCGCCCGCCATCCGCTGCCGCGGCAGCTTCTGGTGCCAAGTCTATCAGATGCATTCGCTCGTTCCTATCGCCACGATGGTCTCCGTGCTCT
GCCCGAGACGGCCACCTGCCGCGGCCGAGCTCAACCACTTGGGGCCCGCCCAGATGCGCGTCGCTCGTGGCGGTGCAAGTCTCGGTGCAGCACACGACTA
AGCCTATCATCGCGATGAGCACGCGTGCTCTTCGCGTGGTTCAGCAGCGGCACCACCACCGCTGCCGCCGTGCGTGGCGTCCGATTGCAGC