Description :
From Genome Similarity Track
Location :
Scaffold_1576:1024- 4099
Sequence
3075 bases(100 bases per row)
CTGGAAGACGTAACACGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACATGTTCCCGCAGTACCTTGGATCCCCCATC
CTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGT
GCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGCTCC
TGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCT
CGCTGGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCT
GTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAGCTCATCATGGAAGTCGTCTCCCTCCACGGATTCCATCTCCA
CGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGCCG
CTGCAGGGTGCCCGAGAAGGTGTCGGAAGAGCCGGTGGCCGTCTGGTCCACTGGCGAGTCAGAATTTGTGGGCGATTACCTTGAGCCCGATCTGACGATA
ACCCCACTGGCTTCTTGCCGGTTCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCCGAGTCTTCATGTTCACAGGGAC
TTCCTCTCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAACGTCATGCGTCGGGGATCGGACGACGTGTCGGATCCATCTTCCG
CCGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGC
AAAGAGGTCCCGCGTCGTGGATACTATGAGATCCTAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACGCCAGCTACGATGCCCGACTCCGTAAGCAAA
CGTAATAGATCTTTGACTGCCACCAACTTGTTCGACGTTTTCGTTGGTGCTCTCACCGGTTCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCAT
GACAGGATCGTGATGTAGGAAGTCGCGTAAAGCTTGGTGGTGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACTGGATTCAGCTTGGTCTTCTT
CCGACTCTGAAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGAGCTTGGGTTTAGGTACGGTGTTGG
CTTAGCCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAG
GGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAACCTCCATCGATCCGCGG
ATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTG
AAATCCCGAGTCACCAAAAGATCCGGGCACGCGCATTATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAGCTTACCAACTGCACC
CAGGCACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGG
TAGCTTCCGAGGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGAT
GGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATTCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGT
AGTTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAACCTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGT
CGAATCTGCACAAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTACCCAGTTATCACTACCAACACTAGATTCGCAACTCCCAACCT
TCTCCTAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCGGGAAAGCACTTGCGTGATACTGTGCAAATTGAGGACTGTATTGATATTTAAGCCTA
TACCTGCCTGGATTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCTCTTCTTCCCTTGACCCATCATCCCAGCTGT
ATTATCTTCAGATCCACCGGATCCATGACGTAATCATCATGGTCACCCTATTATGTGTACACTCATCCGGATCCAGGTCGCTTGGATCCACTTCACTGTA
AGTTTGCACTCGTCGTCGATCTGAGCTCTCCCATCATCCAACATCATCTCGCAACCGTCTGTGATCTCCATTGTCCCACGAAAGTTCGAGATCCACTGTA
TCCATCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATCCGAACTCGGAAGTATGGGATCCGGGGTACCTCGCGGTGGA
TCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCTTCAGAGGGCACCGACCATCCTTCCTTCATAGGATCCACACTCGATCCACTCTTGTATAGTAT
ATCCCATTTCCATCTTAGTGAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTAC