Description :
From Genome Similarity Track
Location :
Scaffold_1895:1024- 2028
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1895-snap-gene-0.1Chaperonin

Sequence
1004 bases(100 bases per row)
GAAATTGGCGACGTCGTTCCCGTGCGTGTGCGGCTCAAAGAGGTCAAGTCGGGCATCAGCAGACGCTACTACTCGCACGAGGATCGCACGTTGCTTCCGT
CATACTTGACTTGGGATTTCCTGGCGGAGCAGTACAACACGTTCCTTGACGATAACTATATTGACACCTCGCGACCGTCTGCGAGTTCGTTGTTTCGGAC
CCTGACCAAACGGTGCCCTCAGATCCGCATCCGCGCTCCACGCAGCCAAGTGTGCGACCTGTGCGCGATCTACCGGAACAGCATGGACGCGAATCCGGAC
GGCAAGGACGTTGAGGTGCTTGGCAAGCATATCCTGGAGGCCAAGGCAATGAGGTCGGTTTGTGATACTTTCGATTACTCCGGCACATTCTTGTGATATG
TTTGTCTGAAACCTAAATTTTGTTCCTGCTTCCCATATAGAACGGAGTACAAGATCGACGTCGCTCGTGCATCAACGGACAACCTCGTCTTCGTCATGGA
CTACGCTCAGAACCTGACGCTGCCGCGCGCGCCGGATACGCCATCGAGTTGGTACTTCTTGTCGCTCATTGCCGTGTCGCTGTTCGGTGCCTACAGCGTA
AATGACAATCTGCACTACCACCACCTCTACTCAAAGAGGGAAGGAGGCAAAGGGCCGAACGAAGCGATCAGCGTGCTGCACAGTACGCTCGACCTGTACT
CGCTGTTCGACGTCGCCTACAGCAATACACCCGACCTACTGCAAGGGCCGACTATCGTGACTGCTTGGTGCGACAATTGCGCAGGGCAAAACAAGAACTC
GTTCGTGGTCTGGTACCTGCTCTTCCTGGTGCAAAGCGGCATCGTGAAGGAGGCCAATCTCAAGTTTCTTTTGCGCGGCCACACGAAGAACGCTTGCGAT
CGAGGGTTTGGTAACACCCGCAAGCACCTCGCCAAGATGTCGTGCTGGAATATGAGCGACATGGTAGAGGTGGTGAGCAGCGCAGCTGAGTCCAGCGAGG
CGAT