Description :
From Genome Similarity Track
Location :
contig_85:10239- 33163
Transcript NameFunction/comments
g12312.t1hypothetical protein
g12313.t1hypothetical protein
g12314.t1hypothetical protein

Sequence
22924 bases(100 bases per row)
CAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCC
AGTCTCGTATCCTCGGTTACTTCGGGTGCTAACCGACTCTTCGGTCGGTCTCCGAACTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGA
ACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCAAACTCTTCGATCTTTTTCTTGATCCTGAATGGCTCATGCCATCGGTGGGCGAGTTTCTT
GGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTCTGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGTCAGATGTTGCCCCCG
TCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCATCGACATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCG
AGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCG
AATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAG
AGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCAC
CGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATG
AAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTG
ACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAACAGTAGTAGGGCTGAGTTACGAGACTTCGGTAACGGTATGACGAAATCCATCGACAC
CATCTGGAACGGTTTTCCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCA
TATAGTCCAATCCAAAAATAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTT
CCTGAATCATCGTTGTGGGCACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATC
CTCGCTAAGCACGAACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGAC
CATCTCAGCTCTTCATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTA
CCTCGTTGCTCGATTGCTCGGCTCTCAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGA
CGTTTCATCTGCAAACTGGACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAA
GATCTGTCGCGGGAGATTCCCGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTC
TCCGATCCGGTTCAGCTCGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCT
GCAGCGTTGAATTCTCGGACCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTC
GACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTT
GTTCATTCCAGCATACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCAC
GAGCAACTGCCATATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGT
GGGGGTCCATACGAGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAATCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGC
TGAGCAAACGTGCAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGA
TTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAG
ACCTCCTTCTCGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAG
TGGAGCTCAATGCCCACTCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAG
CGCGCGAAGCTTCGTTTGGCCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATG
AATCGACTGTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGC
TCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAAC
CGTTGGAGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATCATCGACAAACGACCGTCGGTCGAACACTGGCACCA
ACGAGGATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGC
CTCGAATTTGGTCGACCGAGTTGTTGACTCCTCGGGTTGTCGCAGTGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGC
ATAAGCTCCGAAAGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCC
AAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCC
GCATCAAGCGAGCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCA
GCTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGC
TTTCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATA
TCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGAC
GGGCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATA
GTCCGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCACTACCTGAACCGTCCCCCGGGTAATCTCATGCATCATTGCTAC
GAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCG
CCACCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGTCGGTTCC
TCAGTGCCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCG
TTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGC
CACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTG
AGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCAC
ACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTT
GCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGG
ACTCCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTA
GCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGGTCTGGAACTTCGCGCAAGCG
CAACCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGC
AATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGA
TTTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTC
CTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGT
TTGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGA
GAGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGC
TTAAAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGT
CTCGGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGC
AGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATAC
TCCTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCCACGCGCGTCCACCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTG
CGTCAGTGAGAGTGACCCTCGTCGATATGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTC
GGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCC
AGATTTTCGCTCTCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGG
TCTTCGCACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGT
TGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACGC
ATCGCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCAT
TCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGA
TGTTTCCGAGTGGGAGATGCGTGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACAGCGCTCAGCTCACGAATTTGGCGTGCCCATTCTCCCGTC
AAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCATCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCGCTTCGTCCAG
CAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTCGGCGTCACCATGTGAGAGTCTTGGAAATACGTCGA
CGTCGCACCTTGGGCCGAAAATATTCCGGCCTCGGTGGGCGTCTCCCAGGGGTCACTGGCAACGGAATCATGGACGGGTCGACCGGATCCGATGCGTGGC
GGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGTCCTCGGGTGC
CCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTATTCCAC
GACTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTCTTCACCTTCA
TGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCATCCTCGGCCAT
CGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAGC
GACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTCGTCATCTTCCT
TGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCGGAACGCCCCGA
ACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCTTTCTTCTCTCG
AATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCAGAAA
ATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCC
TTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAATGCAATA
TTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAA
TACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAACA
AACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACGAAGACGGACTTGA
CCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTATATCTCTAT
ACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACGAAATGGGTACAAACGAGGCTTTTAATC
TCGGCCGGGGTTTTATTAGACCCAGCCGAGAATTGTCCCTAGGTCACTATAGCGCGGGAAATGAGACCCGCCAATCAAGACACTCTGTCGCCGTTCACTG
AAAGGTGCAACGTCCGCCAGACCGTGACAGTTCGGCACCAAAACCCAACGCCACAGTTTTCATTCGCCATCTCTTTCATTAATTAAACCCAAGATCCTTG
TCTGCCTCATGAGTTTCTTGATCAATGTCCCCTATATCTGGGACTATCCTCTTGTCATTTGGCAATGACCCTGTAGGATTAAAATAATCTGCAACCTTCC
AACGACAGTGGTCTAATACTCTATCCATATTGAAACGTTCAAACAGGCGAAAGTTTTCCACCACGAATAGCATCAAATCTCTTCCACTTGCCTCGTTGTG
ATGACGCTGAAACGACCGCTTAATGTACCCGGACATGTATTCTATCGGATTAAAAAAAGGGCAGTATGCCGGGAGAGATATTGGCCCGATGTCGATGATT
CTCAAAACGTGAGCGATATCTGGATGTCGGTAAATGGATGCACCACCCAAAATCCACACAGAGTACGATCCTGGATGTTGACGCACCTTACCTCTGGTAG
AGTAGTCGAAGTCACTGCGAATGGCAAACGTGTGCCCTCTAACAGAACACCCCCTTTCCTTATCATCCCGCGATTGTCGTAGGTGCACCTACTTACGCCC
CCTCCGTTTCGCAGGTGACTTTACTTTTATTTACTGTTATCACTTTGGGTATCCTTTGAGACGCCGTGTGCAGCCTTAGACTTCAACAAAAGGTGAGTCA
CGTCCTGCAGCTTCTTGTCGTATGCCTCAGCAGCATCAAACGGTGGCCGCCGCTGGTCAGACGGCACGCCAGTCTTTATGAATCCACCTACGATCGTGCT
CTTTGACAGCCCATTCCAGCTTGCATGCAGCCATCACACTACAACCTCACGTGTTGGAAGACTCAGTACAAACTTACCACCGTCGCGTTGAATCTGTCGA
AATTGTTGCTCGATGTCCGCGAGCCACTAGGTCCACAACCGTAGCTTCAACGGGCGCCTCCATGCGATGACGGCTAGTTGGCACACCGATGTGTAGCCAC
CCGGGACTTTTAACATCACAGCATTCAGCTCATTGGCGCATAACTCTACCTCAGCCGTCCAGTGTCCGCTGAACTCGTCCCAGATGAGGAGAACGGGATC
GTCGATGTTTGGCTGCGTTGCAAAGTGGAATTGCAAGAATTTCACTGAGAGCCCAGCATTCCACCACCCGCGGCTGTTGTAGTAGATCGGCATCCGGTCG
ATGCCTGCATAGCTTTCACTTTCTTCCACAGGCCACGGCCAAAACCTTGCTGCTCCGCACGATGGTGAAGCTCCGTAGCCGGCACTCGCGACGGTGGCTA
CTTGAACACAAGGAAGAGGACTCGCTTGACTCCTCTTGAATCAGCAAGCACCATCACTGTGAGGCGGCTCTTCTCTTTGCCACTGTTGCGGACCCACTCT
GTTCGGGTGCCGGACTCGTCAATAGTAGATGCTCAAAGTTGAGAGCCGTCTGGTCGGTGTTGTAAACTTCCGTGACGCTGTGCTTCAGCATCGTCTTCTG
GACTTTCTTGCGGTCTGACACTTGGCGAGAATCGCTGGGTGTTTGCTGCCCGATCCGGGTTCGTCGCCGCAGCGAGAGCCTGAACGACTTAGGAAACGGC
GACGCCACGGCGAGCTTGCCGAAAACTGGCCGTCGCGGAGCCCAATCATGGCGGCCACAGCACGAGCCTTCATTTGCAGCATCAGCGGTGACGCTGTTAC
ACCTTCCCGCGTTAGGTCTCGACCCAGAAGGCTAGGCGGTCCTCCGCAGCCCGAGGCAGAGTGGCAGCCTACGCCGATCGTGGCAATTTGCACAGGTGTC
CGTTGCCGAGCGTGACTTGCTTTGCGATCTCTGCACTCTCCTCAAGCCACTTGTGAAGCTGGTGCTTCGTACGCTTGCGATTCGCTGCTTGGAGAGGCGG
GATGAACCGAGTTACCGCTGCTGCCATGCGTATTTATCGATGTAGCCATTTTATGAGCGCTTGCGCTGGTAACTGACAGCCGTGCGCACATACTGGGGAG
TGAGCTCTGGAACCCTTTGATGCGGGGCGGCCTTCTCGCGCATGCGTTGCTGCCCGTGCGCTCGAAGAGTGAGGTGCCGATGAATGGCTACGCTCGTGGC
TTACGAATTGACTGGTGGTAATTATTCGGAGTGGCTTTTGACATGACATGATATATGACCAAAATAGAGCGATCTGATAGGTTGATATTTTTAGAACCGT
CGCCTGCAAGGGGTGCCTTTCGATAAGGTTTTTACGGCATGGCCACACTGACATTCCTGCACGAGAGTAAAGTTTGTTGACGTAATCAATCCGTGGCAAC
CTGTACTTAAATTCAAGGCGGGGCATCTTGGCATAGAAAATCTAGACATCAACAACATGGAGAGAATCTCACGCGGTCGAGATTGTGATAGCTAGCATCC
AAATCTGGTGACACGACAAAGGCGAGTAGCATGCACTCACAAAACGACGAAACGAACACGAAGAGCGACAATGGTAGTGTAGGACAATCTTCGTCTTTTG
GATGATCGAGATTGCAGTAACTGATTGTTTGAGCGGTGAGGCCTACAATCAATATACAATCTATATTTCCACAGCTCTGCCACGAACCAATTCATGCTGC
CACGAAAACGATCATCTGGACAGCGTGCTCGAACGTTAGGGGTCACAATTGTGTTCGCCCTGCCATGAGAGCTGCGACCATGAGCTGCGTCTGAAATATA
CACCACAGAATCCATATTAGCACACAGTTGGCACACCACAGCAACCGTGGCCCGTACCTTTGGGTTCGGCATCGCCACCAACTCCAACACGGCGTTGATA
GGGGTGAAAACCTCGCAATGACCGCAGCTAACACAGCGTAATTGAAAAGCGCGCTTCGGTAGAGCAGTTTGTTTTCCCAGAACCCTTCATGAATGGCTGC
CCCCGATAGTTGGCCACGAAGGTGTTCAATTGCAGATCGACGACATGAGAAACATGATGCTGTTGACCATTCGGGTGGAAGTTGCCATCCGGGTGCATCG
CTGGATCTCCTGGCTCAATGAAGGGTTGCGCCACGCGAAGAGCTGCCGCTAGAAACGCTAGATGGATCACAAACTGACCAAAGATCGACACCAGCACGGA
GATGCAGAACACTCCAGACGGCGGACGCTGATGCGAAAGCTTTCGTGCGGGTTTCGCACGAGAAAGAAACAAGAAGAACATCGCAATGGACAGCTGGACA
CACACAAACACCACATCATTAGTAGTGTTCGACTCGGGAAACATGGCGCAAATACACTCACCCCCGATATGGTGAGCTGCTGATCGCCATTTTTCACGCC
AAGGATAAAGAGAGAGCTTAGGTAGTACGCCGTGATTAGACAGTTGATACCCAGAATCTTGTACATCTGGATCGTAGTCACCAGCGTACATCGTCCCTGG
CGGATCAGTTTCTTGATCACGCGGATACTCGAGCTCTTGGAGGTGAACGGAGACGCGATGGAAGCATCTCCCAAACGCACAATCTGAACATCATCGTTGG
TATACAAAGACTGCTGCAACTCTTCCACTGAGTTCCCCCTGCTCCCAGGGTGTCGGCGGTGGCGAAGACCATTCTGAGCCGTAAATCTCCCCGCGCCTCT
CCCTGCGTCAACCACATGAGGGGGATTCTCGGAGCTGGACGAATTCACAATCGAGATACCGATGTGCGCTTGCTTCAAGGCACCCACGTCGTTTGTACCA
TCTCCGCACATAGCTGTAGTCTTGCCGCGCCGATTCATCGCCATAATGAGATGCTCCTTTTGTTGAGGTGAAGTGCGAGCAAACACCGTGATGCACAGAC
AAATCTTCCCAAGGATAGCGAGAAAGCCCTCCAGCGCAGCCGCACTATCGCTGCACTTGTCTTCCTGTTGCTTGTAAAGCATGGCTAACGCTTCTCCGGT
CACACACATATCGTACTGAACTTGCATCTTCTCCACTCCGTCGACATTGAAAGGAATAGTCTCCTCCTCGATGTCAGGTGACCCGTCGTCGATGGACTTC
CACTCCACAACTCCACTCTCAGTGTTCGATGTCAATACCAATGGCTGCTTGGAATATTCCGAGTTAATCCCAACTTGCCGGGCGACATCACACGCAGTAA
GAGGGTTGTCTCCTGTGACCATAGTAACTTTGTGCTTGGAGATCATCAGCTCCCGAATTGTTCGCTTCGTGTCATCCTTCAGTGGGCAATCCATGACCAG
GAATCCCGCAAATGTTAGTCCACCTTCCAGCTCACAACGCGGCTTGCGCCGTAGCTCTTCTGGGGAAATTGCTACAGGGAGGACGCGAAAGCCTAAAGCC
AAAACGCGACATCCCTTTGATGCATAGTGGCGGTAAACACGACGGTAGTACGAAGGCTTTGTACTAAAGATCGGCTCGAGTACTTCAGGCGCCCCTTTCG
TAAGCACCCGCTGCTCGTCTTGCTCATCGTTATCAGCCTTTCGCACAGTTACAACGGTGGTCATGCGCTTGAGCTCCGAGGAAAACGTGAAGCTGTGCAA
AATATCAACAGCTTGGATTTCTCCCCGGCGATCAGAAAAAAACGATGGTTGAACACTTGGGAGTGCTCCTTCTCCATCTTCGTTGTTCTCCAAACACCAC
TGAATGCTTCGAACAGCCGTCATTTCCAGCGGGTCTCCAGCAACTTGGCCATTAAGCAACACCAATGACTGACAACCAGCAAGAACGAGCTCTGTATCTA
GAGGAAGTTGCTCTGGTGCAATGATATCCAGCTCGCCCCGATGCTTGCTCCTGGACTTATCAGGCTCAACATGTGTCTCCAAGCCAGCCACGCCGTGAAG
CTTGAGTTCATCGCTGGTTAATGTACCAGTCTTATCGAAGCAACAAACATCGATGCGCCCCGCGAAGGGGATTCGAAACGGCTCGGTGCAAAAAATATTA
CTTCGCGTCAGCGCGATCAGCGAGTTGGTCACTGCTAATGACAGCTCCATGGGGAGCTCGGGCGGCACGACAGACGTGATGATCATAATACAGTGAAGGA
ACAGTTTGAACTGGTTGCGTGTCGGATCATTTATTCCTTGTGCGAGCACAAACGCGGCTGCAGCCACGGCAAAATTCAGCAACAGAACGATAAACCACAT
CGCTTCCGAGTTGTTTGCAGTAACACGCTGCGACGAGTACAAAATAGTCCGCATGAGACTTCCTTGCGTCGTGCCAAATCCTGTCCGGAGCACAAACCCA
ACGCAGCCTCCATCAGGAGGTGTAGATACACGCAGCGAATCCTTCGAAACTGGTGTAGTGTGCTGAAGAATTTTAGTGCCCCCATACAATACATGTCTTT
TGTGTTTCATGCTGGAGCCATCGTCAACCTCGAGATTCTTTAGTTTCTCTGCATCATTCACAATCGATGCCATCACAGCCTCCTTGCGCAAAGGAATGGA
TTCGCCAGAAAGCATGGACTCGTTCACCACACAGTTACCACGAAGTAAAAGCAGATCACACGGCACTACCGGTACGGTACCGCGTTCATGGTGCCCAATA
GAGCAGATATCACCGGGAACCAGCTCGTCACTTGACACCTGGGTCCACGTGCCCAACCGGTAAACCAGACACGGCTGTGGAGCGCGGCGCATGTGCAGCA
GTGTGTCCATGTTCTGCTGGCGCTGCTTGACCACCGTGCACTCGAAGATCACGAGCATGAGCAGCGTCAGCAGCGAGTAGTACATGTACTCGTCGAGACA
CCAGAGCAGCATGCAAAAGAACTGGAACACGAAGAACGGCGCCACCAGCTGCTCCTTCAGCAGCTCAGTGAAACGAGGCATGGGCAGCTCAAAGTCGTTC
CTTCCGTACTTGCCTCTCGCCTGCTGCAGTTCATCACTCGACTGGATGCCTTCACTCTGCAGATAGGACGCCAGCGTGTCGCTGGACGGGAACTGCAGCC
GACGGAACTGCGTGTCGCTGTTGCTGTTGATGGTCTCCACGTCCTCGTACAGACAGAACTTGAGGTTTTGGTACGAGAACCAGAGCGTGGGCACCTGTGC
GTCCTTAAGCTTCTTGTCCTGGCGGTTCAACTGGCATTCGCAGAGCTGCTTGGGCAGCATCGAGAGTGACGGGTCCACCTTGGCCAGCATCTGGACGCGC
TTGTCCTCGACCACCGCCTTCAGCCGGACGCAGCTCATCCAGCAGCGAACGTCCACGCTCCACTCGGTGCCCAGCAGCGCCAGCGCATGACAGAAGACGA
TCAAGGCGCCAAAGACCCACGGAACAACGTCGTCCTCGGGCCGCAGCGTGTACAGATATGCGGCCGTGGCGTACAGGAAAAGAAAGGGCAGCAGGTCCAG
CCGCATGAGCCACGGTAGCGGCGTGTACAGCGCGACGGACGCGAGCTCCGCGTCGGCCACGCCCACGGTCAGGACGCCCATCGTCACTTGCGATCCAAAA
CCGAAAATGAAAGGAACGCTAAGTACGGAAAAGGGCAAGTGCAACGTGTCAAACAGCGAGATGGCAGCGGAAAGGATTTTTCACCGTAAAGTATACAGTA
TTGTGCATTTGCTGCATCTCTTCATACGGAGAGAGGAAGTAGGTTGTGGAAGGGATTCGTCAGATCATCGTAGTCTTAAGAGTTTGTGTTTCGTCAGCTC
ACACTTGTGTGCAAGGTCCGAATAACCAGATAAACAATCATCACTCGATCCCAATGGTCTACAGCTGCAGCAATGTGACTTGCGCGGGTGGCGTTTTCTT
CAGGGAAACATGGTGTCCTCATTCAAGTCAGACATACGCTTGTTTAAAAAGCATCAGCAGAGAGCCACCACCACGCAAACGGCAGCAAGTACAAATGATA
CATTTCTACAACTATTCACATGAAGCACTGTCTGGAGGCAATGCACAATACACAGACGTTTGCAGCGAAGCCTCAGTTGGTACCCGAAAAAGTTGCAATC
GACATGAATTGGTCCGTTTGGTGCAATATAATCACTGGCTTTAGCAATCGATGGGGACAGCAGGAAATTGCATTGGGCTCTGCGCCGGCGAGTTTAATGC
GCGCGCGACGAGGAGCAGAAGCAGGAATGAATAAGGCGAACGTGGCGGCATCGCAGCCGCGAATTGGTTGGCTGGCTATAGAACACTTTTTACGTCCGTA
AAAAGGTAATTACGCAAACTCACATCTATGTGCGTCACATCAGCCAGATGTTCCGTACACCATGAACGATTCATACAAAGGCCAAGATATCGCGACATAC
CATACAAAGTCCAAGTGATCCGCTGGATATCCTTGGAAATCAGATCACGCGCATTCCCCCACGAGTCATGGCGCTGCCCCGCGGCGACGACGGCGACGCG
GAGCTGCAGCAGCTCAAGCAGAAGCTGGATCCGCTGGTGTTCGGACGCGATGTCGTGTCTCTGGACGAGCGCCTGGTGCCGCGCGGGCCAGAGACCACGG
GCTTCGAAGTGGAGCCGCCCAACAGCAGCTCTTTCTACGGGGCGCTACCTGCCGACGCGGAGGATGAGGACGATGAGGACGACGACGTGGAGAGCCTCGA
GGCGCCCGTGAACCGCTACGCCGGCGTCATCTACGCCGCGCGCTTCTTCGTGACGCGCGTGGGCTTCCTGCGCTCGGCCAAGCGGCTAATGGTGCTCAGC
AGCAGCCATTTGACGGTCGTGGACCCGTACTCGGACGAGGTGAAGGAACGTTACGCATTCGACAACATCAAGGAGATCACCATCGCCTCGGACAGCGGCG
GTCACAACGCCGACCGAGCCTTCACCATCTTCATCGGCAAGAACCTCAAGGAGACGTACACGTGTCGGTGCAGGCAGCAGCTGCTGTCCGCCTACTACCA
GCTCAGAGAGCGCGCGTCGTCCTTTAGGAAAGATGAGATCGATGCAGCTACAGCCGACGCTCTGAGTGCCGTGGGCGCCAGTGTCGGGACAGGAGACAAC
AGCTGGGCCACAGGATCCGGAGGACCCGGCGGAGCAGGCGCAGCGAACGCCAATATGCTGGGCAGCGGCATGTACTTTGACAGTTTGTTCCAGCTGTGTG
GCAAGACGTTCACGATGACAAAGCTCAGCACGACGCGCAGCATTGCGATCCACCCAGTGAAGGTGGATGTGCTGCTGGCTGTACGAGCCGCGAGCTTGGA
TCGGTTGGACCCGCAGACGCGCACTACGCTGTCCTCGATTCTGCTCATTGATATCGTCAAGATCCAACGGATCAACACCAACTCCAACGAATTGGTGCTT
TACTTCGAGAACAACCGCGTGCATCGCTACTGGTGTGACAGCCGCGAGCCGTTTATTCAGGCCATTGCGAACAATTTGCGCTCGTGGCTGAGCGTGTCGC
TTTTCGTGGAGGAGGTGTCGGACTCGTGCGAGTTTGACGCACTCACCTCGACGAGGGATATCCCACAGCCTGTCACATTCGAGATTCCTGTGCTGAAGAT
CAGCAAGAATAAGTCGGACAAGTTGCAGCTGCGGTTGCTCGGTCTGACCGCGTTGGCGATCATTGAACGTGACCCTGTGACGAGGAAAACACTGGCAAGT
CACTCGTTGAACGACATCTTTAACGTGGTGGTTTACCCGTCGGTATCTTCGGCTCAGGATGACCCCGACAGCGAATCATCCGGGGTTGAGCGGTAAGTTT
GCGCTAGAACTGAAGCATGGGCTGACACGTCGGTATCTCTGTCTCAGCTCAACGGTGAGCAGGCGCGATAAGGAGGTGAGTCTTGGATTGAAGCGAATAT
CATCGCAGCATGAGGATGAGCTTCGCCAGATCATTGGAGATATCGCTGGAGATGTGAGCGTGCCTGAATGGTTAAATGTTGCTGGATCAACGACGTTGCT
TAGTCCGAAAGAGGCACGGAGTTTGTTCCTAAGCAACATGATTGAGATGTGTCGAATGAACAAGCTGCACGTTCCGTGGTCGACAGAGGAGACGAAAATT
GCATGCAAGGAAGGAACGTGGGGTACAGAGGTTCACCCTGAATGGGAGGATATTCTGTTGCGCAAGCTGGTCAATCTGAGCTTTATCCCGAACCTCGTGA
CGAATGAGAGCATGTCGCTCATCTACTATCAGCTGGTCCAGTTTAATCGCAATATTCCGTTGGGAGGTCTTCGTCAGCGCGATCGTCGTGCATTTGCGAG
TCTGATGAGGCTGCTCGAAAATTTTAAGGACTATTCTGTAGCCCAACTCAACAGCCCTTCCAACACAGATGCACCGATTCCGACAACAGAGTTCCAGGTG
GAGCTGCTATTGGCAATCCAGCGCTTGCTTTGCACTCGAGGTGTCTTTGAGGAAATTCCAAGTTCACAGTACAAGAACAGCATTGAGGTCATCATGGAGC
TGCTTCATTCTCCGATGGAGGAGGTAAGCTTTGCGGCAGCGTGTGTGATTAAGTACATGGTGGTCAACTACTCCGATACGCGCAGCTTGAAATCCGAGAC
GGCCAATCGCCGCGCTATATTCACGAAGTATCACAGCAGAATGTATGTGTCTCGGGCTTTCGATCTGTCCCGGACAAATCGGGTAGGACGGATGCCCTTG
CATTCTGCTTCTTTGGTAAAGACAGGGTCGGGTCATGGATCTCTCACAGTAGCTGCAATGTCCAATACTGAGCGCAGCATGGCTAATGCGCTTGCGTACT
CTCAATTGGGACTAGATTACCTTGTCCTTGCTATGGTACTGCAGACACTGGAAGTTTGTTTATCCAGCGGAAAGAAGGCGACTCCTGAAAGAGTGGCAAG
GGATCTACTTCGAGCCATGAGGGTTGATGACTTTTCTCGCCACCATGCTCTCTTCTTATTCAATCGATCTCTAAGCTTCTCGATCACGAAGTGCTCCTCA
ATTTTGGTGAAGGCGCATATTTTGGAGCAGCCCACTGAGCTCGTCGAGCTGATTCAGGATTTTGCACGGAAGCACGGGGCGCTCGTGTGGCAACTTTACT
TGGCACTGTATACCCAAGACAAGGCACAGCGGCGGATTTCGTCCCAGCTTGTGGCTTTGCTCACACATGAAAACCCGCGTTCATCTTATGTGGTTCGGAA
TATTTTTCCACACGCGTTGTTGGATGACCTGAAGACCAGCCAACTAGAGTACGACGAATACGGCAGACATCTTCCGACCGCAAACCCTGAGCTTTACGCG
AAAACCAACGGTGGTTCGCATAAAAATGGGGGCCGGCGTGATATCACCAATGCAACGGAGAGTGGGCGAAGCAAGCTGAGCTACGGGATCAACACGCGAG
GTCGCTTGGCCCGAAACGTTAAGTATGCCGTGCTCTTACCAGAATTCTTTGACCGTCTGGGTAAAACCTTTGCGACCAAGGATCTTGTGTGGGCCCTAAC
GCGGTCGAAGAACTGATTCGCAAGCTGCAGGCAGAAATGAGTGATCTGGACTTGTATCGACTGAAGTACTTGGGGTATCTTTACACGGACCCGCTTGCGA
CTGATCACACGGAGACTGAATGGGATGCGTTCCAAGCAAATCGGCTTCGCCACAACGATCAGCAACACGCCAATTTTGCTCCGTTTCTTTTTGAGTTTTT
GCAGAACGGTTCCGAAAGTCGACTGGCGATTGAAATGTTGAAGGGAACGATATCGTCATCCAATCGATTCGCGCGGTTCATGCCTCTGTCGTTCCTGCTA
AACCCTGACACGTCAGGCGACGTCGAAAGTGACGGCGGACTGGATGATGACAATTACGACAGTGACGACAACTACACGGAAGATAACGGGTTCGTATCTC
GCTCAAACAGTATCGTACGCACCGGAGATAACCCGGAGACCAAGCAAGACGACCACGATGGATCTCACGACGAGTATAGAAATACCACCTTGGCCAAGAA
GAAAAAGAAAAATGCGAAGAATATGCCACGGTGGTTTGTAGCTTGGAATTGCAACGAATTCCGCGTGGACTACGAGTGCCTGGAGAGCGAGGTGAAGGTT
GGCCCGTATTACCTTGCAAACATTCTTGACGATCGTGGCGTGCTGGTAGAAGATATCGAAGGTGCAGAGAAATTCATGACGCTGCTGTATTATCGTCTTC
TTGCCGAAGACCGTAGCATTTCACCCAAAAGCTTCAAAACGGGTATTCTTCGTCGGATTCGCTGGGCGACGTCGACCAGTTTGATATTCGTTTGCTAGTT
CTCAAGGTCATGATTCAGCTGTATGAGCGTCATTTCAACGAGTTGGGCTCTCTGATGTTCCTAAACCATTTTCTCCGTGCCAGTATGATGAAAAGCCGAG
ATGGTGAGGATCGACGTTGGCCGTTAGTGGTCCGTGGCAATATCATGCTTTTCCTGGATCGCGTGTTGTCGAGTGCATTGAATGTGTCGCGCTTCTTACG
TGAAGGCAACAACGTAACAATGGTATTGGATTTGCTTCGTGAAGTGAAGCCGCTGGTGGTTCTTCAAGGACCAAACGATTCTGAAAAGGAGTATATCGTT
GAGCCTGCTGCTGATGTTCAAGCAGAACTTGATGCGTCTGAAGATGAGAACGAAGCTATCGATGATGAAGACGATGACGAGTACGGTGGTGACAGAGGTG
AGTACGACGACGACGACGACGACGACTACGACGACGACCGGGATATGGCGAAGAGAACGATTGATGCGCTGGAAGAGTCAGGTGCTGAAAGCTCTATTAT
TTCGAGCCATTCTATCTCGCCAACTTATGCACACCGCGATGACGAAAGCGTCCACGAGGAAGAGCCCACTCGCGTGACAGTCGTGGCAGAGCATTGTGGT
GCCATGAGTGGGTCGATGATTATGCAGACCTGTTTGAGCGTGCTCAGTCGCCTCATCGATTGCCATACCGCCGAAGAAGAAGGGCACATGCACCAGGATG
TGCGTTTCCCCAAATACGGGCGGCTTACGCACTTTGAAGGTTCGGGTGTGAGTCCAATTAGTTCTATCAAGCACCGGCTGTGTGAAGATCAGACGCTGCG
GTTCTTGGTGGGACTCTTGGATTGTCCGAATCGCATTGTTTTCAAGAAGTGCCTCGGATTGATTCGACTTCTTGTTAGGCACAACGAGGCAATCATTCCG
AACCTACACGCATCCGGCATCTTTTACTATCTGCTTCGCTTTGCCCAGGATGTGGACGAAATGTCGATTGCGGCGCGTCTTATTTCCCATATCCATCTGC
GCCAGTCAGGGCTTGATGTGCCTCACCTGATCGATGACAAGCAAAAAGGAGAAAACAAGAAGGGCGTTTTCTCTCCTGATCCATTAACACGGATCTGCTT
GAGAAGTTGGCTGGTACGAGTGCTGCCAGTTTCGATGGTTGCTCAGCTGCTCCGTCATGGACCACGACGGTTTGCCACTGCTCTTTTCTCGGACGCAAAC
AACCCAGAAGTGGTCTGGAATGCAAACATGCGCAACCAAATGGTTTCCTATATTGAAAAGTTTATGGAACGTCATACAGATGAGAACGGCATGTTCTACA
TCTCAGAAAATGAGGGCTCGGAACACAAGGCCTGCATCGCGCTGATCCAGTACCCGAAAGAAGTTCACGCATTGCAGTGCTACCAATACTACCTGCACAA
TCTTCTTGATGAGAAGAATTTCCCTGGGTGGCCGATCAACGACGAGGCTGCATTCTTGCGCGCTCTGCTGGATTCCATTCGCCGCTGGGTGCACCCAGGG
CTACTATTGACTGCTCGTGGGGCGATGGCAACCGACGGTCAGTCCACGAAGCTCCTTTCAGTGTTCGATGCGGTAGAGCTGCTCGACGCCACAGCACTGC
TTCTACGCCGTTTCCCAGACTCGCCAAGTATTACCAACTTGCGCAACTTCTCTTACTTCCTGGAAGCCCTGGAACGATGCATCACAGAGTTGAAAGACAA
CCGCGTTGGCCCGACGAAGACGTTTTTCGACGTGTCCAATGCTATATCAACAAAGGCTACCTTCGTTAAGGCTTTTGGAAGTGCGATTCGTGTGATCAAT
TTGGCCGTTGGAATTTCGGACGAGAACGCTCACGAATGTAGCTCCGGGTTGGGGCTTCGCGTGCTGTGCAACTCACTTCAGTTGCTCTTCCACAACCAAG
AAGCGCTGAGTACTATCGATGGTTGTACGCCAAATGTGATGACACACTGGGTGCTTGAAGCACTCGTGAATGTGTTGAACCAACCTAATGGTCGAGTATC
GGCCGCTGCACAGTCAATCGATTTGCTACCGTGTCTGACACGCTTCCTCTCGCAAGGAGGCGACCGTCTGGCCACGGATTTGTCCCTGCAAATTGTGTAC
GAAATGGCTGGAAGCTCGGGCGAAATGGCAGAGGTTCTGCTACTGCAGCTCGCGGAGCACGGAATCCTGTGGTATTTAACGCTTCTGTTGTTTAACTACC
AACCGAACAATGAAGATAGCGACGGAGACATGCAACGCATCAGCATTGGTGCAGCGAAGGCATTGGGGCGAATCCTGGAAGCCAACGCGAAAGAGGAATC
AATTTCTGTGTTTGTCAAGAGAATGCAGACTACGATCGAGCAGGTCTTTACACGCCCATTAGTGGACATCTTGCGACGAGCGGGGCCGGTTAAAATGTTG
GACGTGCTGGCAACTGAAGTTCGCGAGCCGCACGTGATGTGGACTGAACGCATGCGCAAGGAGCTGATCAGTCTCGCTCAGCGTGCGATCCAGTTCCATA
CAACACTGGATCAGAGCGATGAGGAGGTGCACAAGGTGTTTGAACTGCCAACGTATTTCATGTACACGGCACAGAAAGAAGAATTGTGTGTGGCTGGCAT
CTACGTCAACTTTTTCAACGAGAACCCGAAGAACGGTATCCTCGCCCAGATTGCAGGAACTGTGAATGGCAATGGAAATCGTGCCGACATGTTTAAACCC
AAGCCGACGACAAAAAAGGAGATT