Description :
From Genome Similarity Track
Location :
scaffold_81:10237- 11643
Transcript NameFunction/comments
g2989.t1hypothetical protein

Sequence
1406 bases(100 bases per row)
CGTCATGGATAGTGTCGGGAGACTGATACCCCTCAAAAACGCACGCGTGGTTTTGCTGTTTCGATAGATCCATCAATAATCGCTCCGAATTGCCAGCTAG
AGGGTAATATCCCACGAGGTGCCCTTCCTGACCCGTAAGCGTTTTCGAAATGCTCCAGTTTTCATCAAGATTGGAAAGTGGCGTCGACCAAATGCGCAGA
TCAAGCATCTGTCCATAAAAGCACATTTCGCTCTTTCCTGAATCACAACTTCCAAGTCTAGAGCCGATAGTCAGCAGCGAAGTACTCGGTGCTGAAGGAC
CCGCCTCATCCAGTGTCGTCGACCTTGCAGTTTCACCTGCTACAACGTTATCAACCAAAAGCACCGCTTTTTCTTGGCCAAAAGAAAGTGTGACGTGAGA
AAACACACCAAAGTGCACGCCGTCACGAGAAGTTACGGTGTAACGTCCTCCAGCAATTTGCCACACTAAATGTCCATCGCTGGTCAACAAAAGCTCAAAG
TCGTGGCCATTTGCCAGCACAATTTGACCCTCGCTCTTGGAAGGGGAATGCAGTGGGCGAATCCAGACTTGAACTGTAAACTCCGTATGGTCTGAAGTTG
AGAGCACCGGGCGCTCCAGCACTAAAGTGCTAGCTTGATTTCCTTCGGGGGAATACGCATAAGCTGGTAGATCGGTTGAGTCCATCATCGCATTATTTGC
CGTCGCAAGTGACGTTGCAAGATCGAAACTGTCTTCAATAATCTGTTTCCGCGCCAGCCATACTCCCTGTTGCTCCCCGCGCGACCACCTCATACGCATA
AATGACATATCTGAGCTGAATACAGCAGAGAATGGAGCTGGATTATTGCCTTTGCTGCTGCTGGGGATCGTCGGCACATTAACGTCGGCAGGGCGATCTG
TCCCGCACGTTGAGCACTTCTTCGCACTTCCTTCATTGTTCATGGTACATGCGCGACAGTCCCAGGTTGGTGCTGAAATGGGAGTCATCGGTGCCACTGA
AGTGGTTGGTCCATTTTCATCGTGCAACTGTCTCCAATGCCCCTCCAATTCCCACGTCGAAGCTTCCATCATCTCCGGATGCGCCGACAATACTTGCATC
TCGGGCATCTGCTGGAACAAATATCCCGTCAATTCCAAATTCTGGTCCAACTTAGTATCAATCATCTTCGCCGTCACTTCATGCGCAAAACAATTGGTCG
TCGTCTTCAGCAGTACCGATCCTGCGGTCTGAGGCCCCCCATTGCCATGCTGGTCAGTGATAAACTCGTCCGCCACCCACTTCCCTTCAATAGACGGAAG
CATTTCATCCAGTTTTTCCGCAGGTAATACCCACGCACTTGCTCTCAACAACCTTTCTGCTTCTGCAGCAGTAGGCCGATCAATACGCGACCCGAAGCTC
GCCCTC