Description :
From Genome Similarity Track
Location :
scaffold_20:102367- 106178
Transcript NameFunction/comments
Pl_112106isoamyl acetate-hydrolyzing esterase 1

Sequence
3811 bases(100 bases per row)
TCAACTTGACTCGCTCAACATGAGAAGCATCAAAGAATAAATAAGGTTGTTGGCTTTTACCATTAGCAGTGGGTCGCCACAAAACTCTCATCGGGGAGAA
TGAGTTATTCAGCTCGTTCACTGCCACAATGCAACACTGTCTCCGTTGCAGTACTACGAATACGCGAGGTTAACGACCGCAGACTTATCCTGCCGTCATA
CGTTTACATGGATGTCGACCATCGGCCATATGCGGTATTGAAGCGAAATTCGTATGGATCTACGCAGATGTTTAGTGGTTGATGGTCTTTCGGAGTTTAG
AGAGTTTCATTGTAGTGCCACAGCGCGGGCAAGTCGGCAACCGCAGAAGGGCTGGATACGTACGGACTTGAGCTGCAGTGGTGCATTGGTGGCTATGTGC
CTCGACATTACGACCACCAGGGTCCGAAAACCAATCAGAGCCATCCAAGACTCGATCAGCCCAACGCGTACTTTACCATACTTGTCCGAACCACCTATGT
ATTTCGTTATACTGCATTTCCTACTAGCTGATTGCTATGGACCATGACTCTGACACTTCAAGCTACATTCCACCATTAACTGGGCATAGCGACCTCCTAG
GCGGTCGATACAACCACAACTCAACAGCTAGTGAGGGGCATCACATGCAGGAATTGCTTCCGACCACAGTGACCTCGATAGGATTACGGCTCCATGACGA
TCACAATTACAGAAGGTTGGTTGCCTCTCCATTTCCATTGTTCTCTTCTCGTGGACATTGAAACAAAGCTTTACAATCTAAACCATTTTCAAATGGGCCT
GCTTTGGGAACACATTCAACTATCAACGAATGCAATGTACTCTTAAATCTAAAAGAAGAAAGTTCCGACTGAAATGCTGCTGCCACCGATGTGTTCAGAG
GGCATTCACATGCATGGAATTCTTTGTGATCATCTTGGAACAATTAGAGCTCGGTTGCGGCAGGGGTACTGAGGTATTGATCTGTTGACGTGCGGCGTAA
TGATGTTATTGTCGAAGACAACCATGTCCAGTATCACCCGAACGCACAACTTTATTAGGATACCCTGCACATCGATGATGTCTCCAATGGAAGTCAGCGA
CAGACTTGGTTTATGATCAAACATACTAATTGGGTGATTCCGAGCCTACCATAGTTGTGGACTTCACTTAGTGGCGTTTTAATGGTTGCATAAGTTAACA
GTTTGATAAATAGACTTCAGTTCGAGCGATACTGAGACTGCTTCAATTTGACTTTAGTAGCGTTCGATGGACAATGGTATGCTGAGTGTATTCCGTTGTA
CACGCACTACGGCAGGATTAATACTGTAAACTCACAACAAATTGACAACTAGATAGATCATACCACCAATTTACTGATCGAGTATTGATGCGGATGATTC
CAAAAACGACATTTCACATGACACCGTACAAGCCTCGTAACTTGTGGAATCCTCGTCACTCACACAAGTTTTGGAGTTCGTAATTTGGTCTTTTGCAGCC
TCCTGTGCATTCCATTGAGTCGACTCACCCATGCATTTAGCACAAACGACGACTTTGCGCTGGACCAGACGACCACCAACCATAATAAAGCTGATACATT
GACGGATCTTGCACGAATAGCAGACGCAACCATAGCAGATTTTGCACGTGCTCTTTCCAATGCTTCCAATGACATTGTTTGTCTTCTTCTCACAGACCAC
GCACTGCTTCCTTTCTCGCTTTTTCCTCTCAGCATCGTAGGCTGAGTGGTGGCGCTGCAACATCCATGCCAATTTTTTCATCTGACCGCAGTAGACGTAG
TTGGTTGCTGAAAGCATCGCCCCAGCGGATACAGAAAGCAAGAACGAGCGCATCATGTCACCTCCAGGATCGACTGTTGCACACGCAAAGTTGTCGACAA
CGTTCCGGTCTAACTGCTTGAAGCAGCCAAAAAGTGACAAGTTCGCGCGGATTTTGTTAGGCAGCGGCATGGTCTGCGGGAAGTCGATAGAGTGTAACAA
ATGATAACCAGCGCGATCGCCATTCGAGAGATACATGGTGCCTGTCGCCTCGATGTACACAAAGTCACGAGTTTTGACCAAATGTGTAGACTGCAAAGGC
ACATCGAGTGCCATCCACTTGATCACGAGCGACCGGAACGGATCGTCCTTACTCGGTCCTAGTACTGGACACAATATTGCTGCAGTATGAAGGTCATGGA
CGTATGAAGCTTTAATACGCATGTCGTCTAGTGTCGGGTTCACTGCTGCAGTATGAAGATCATGGACGTATGAAGCTTTGATACGCATGTCGTCTAGTGT
CGGGTTCACAACTCCATACATGAGGTCATCGAGTTCACCAACAAACGTACCCACACTTAGAATCACTGGTAAGTCCTTTGCTGCTGGACCAGCTTTTAGC
CGTTGTGTTGCACTGAGCGAGTTCTTTGGCTCAATACCTCGTCGTTTAAGTTCTTTTCGAGTGCGTTCTGCGTACACATGCAGATTGTCTTTGGACTTGA
CATGCTCCCACCGTTGCTTGTCCACTTTGCGCTTCGCAACTTTGACGAACTCTTCATATTTTGTGATGTAGTCCTCCACGTAGACATCGACGAGATCAAT
CAATTCCTGGCGTTCTAGCTCCGATACACGAACATCGGGAAATGGGTTGACGGCAAATCGGTCCTTCGCCATGTTACAGGTTGATACCAGGTACTCTCTC
TAGAGTAAATTTGCAACTGCACCAAGCTGGCATGTCGAGCCATTGGAAACAGGCACTTCGACTTGATACGGATGTTCAAGATGTTGAATACGGGCAACAA
CTAGGGAGTGCAACATCTGTAACTACATGGTAAACTCGCTTCATTCTAGGTGACCCGTTCACGATGTCTTATCGTTTCTCGAAAGTGCACGTGGACTGCA
GTAGTCTGTTTAAGGCACCAAAACTCAGCATAGGCCTCAAGTTGTGGGTCTCCAAGACACCACACAATCAAATGGATGCACTGCGAAGAGCCAACTCGCG
TAATTAGAGAGCACAATATTTTACCAAAGTGCGATCGATACTAACCCCGGTGGAATGTACAAAACTTCTTCAGTGACAATGGGTCTACGGATTCGGGATA
AGAGTGTATATTTCTTCAATACAATGCGTTTTTATGATGTAATGCTCTATGGATGATCGCAATCACCGGAATACTAGTGCAATATGGGGACATGTCGAAG
GGATCGTCGATCAAGCGGCATATGTGTGGTGGGGAGCTAACCTAATACGCGGAGATTATGGCCAATGCATCCTATACTATAATTGTTTGCTCTCAACACG
TTCAGCTCCGATAGAGACCGTGATGTGGCGAGTAGATTATATGCAGTGAAGTCGCTAGTCAAGATTTGGAAATAATTAAGTGGCTCGCTACGATGATGTA
CGAGTTCTAGGTATCAACCTAGTTGAAGTGAATTGCGACTGGGTTCCAGCCTTGCTGTGATCAACGGAACAATGCGATGGATCAAAACACAGGCAGGCAA
GATGTTTCAGGCCAACAACGACTTGATGCATTGTAATGGCTGAAAAACGAGGATCAGAATGATATAGTGAGTGCCATCGTAACCTCAAAACAATCTTTAC
GAGTACGTTTAAGGCATCGCGAAAAATGGTTTCAAGTTGTATTAATACTTCATAATTATTCGACAGTCTCGAATCGATACACATTCATCTCATCGCTCTA
CTTGATTTTTCTTGTGATTTGAAACATTTCTCCACTGCACTTATCTCTCCTCGCGAAAGATTTCTCGCTATGGGTCTCACAGCTTCCACGGACCGCCGTC
CGGTCTTCTAC