Description :
From Genome Similarity Track
Location :
scaffold_29:102306- 104179
Transcript NameFunction/comments
g1459.t1hypothetical protein

Sequence
1873 bases(100 bases per row)
ACCTGCATGAACCGGCGTTCGTGGACTATTTAGCGCGGCGCTACGGCGTAGATCAGGTCTACTGTCGGTCAGGTGCTGTGCTCATCGCTGTGAACCCGTT
CAAAGACATCACGGGGCTGTATGATCTAGAGAAATTCCAACAGGATATGCCAAACTGGACAGCGTTACCCCCTCACGTCTTTTCCATTGCTGAGGGGGCC
TATAGATCTCTGCGGAGACGACTGCGTGAGCCTGGAGAAATTAAAACGAATCAGACGATCCTTGTTAGTGGGGAGAGCGGCGCAGGGAAGACAGAGACGA
CTAAGTTTATTATGAATTATTTAGCGGAGAGCAGTCGGGATACAGCCAGCAGCAGCAAACGGAAGCGAGCGATCAGTGGCAGTGAACTGATGAGCGCGAA
CCCGATCCTGGAGTGCTTTGGCAACGCTCGGACACTGCGGAACGATAACAGCAGTCGATTCGGGAAGTTTGTGCGCATGTTCTTTGAGGGACACGAAATG
GGAGCTTCGTTGCGGATGGTGGGAACGTCTGTGGAGACGTATTTGCTGGAAAAAGTGCGTGTGGTGCACCAGAATGACGGGGAACGGAACTTCCACGTGT
TCTATGAGTTGCTAGCAGGCGCAGATGACGAGATGAAGAAGGAGCTGCATCTTGACAACCTTTCGGCGGAAGAATTCCAGTATATTAACGGTGGACAGTG
CTTCCAGAGAAACGATGGCATCCAGGACGACAAACAGTTCCAATTGGTGCTGCAGTCGATGAAAGTTTTGGGCTTTACGGATGTGGAGCAAGCTGCTATC
TGGAAGATCCTGAGTGCGTTGCTGCATCTCGGAAATGTGTTGTTTGTCTCTTCGAATGACGATGAGGAAGAGGACAATGGAACTGCGTCATCACCTTGCC
AACTTGCAACCTCCTCGCCGTCTTCGCTTACAGTGCAGGACCATCTGAATATCGTATCGAAGCTGTTTGCAGTGGATCAGGAAGAACTGGTTTCAGCGCT
GACTACGCGGAAAATTAGCGTTGGAGGCGAAACGTTCCATTCAAACTTGAGTCTCGCGCAGTGTGGAGACGCCCGGGACGCAATGGCGCGCTCGTTGTAT
GCATTTTTGTTCCAGTTCTTGGTCTCGAAAGTGAACTCAGCTTCGCCACAGGTTGGACAACCTACGAACTCGTCAAGTAAAGCGACAAACAAGGATGCTG
CGGCGCCTTGTATCGCAGTTCTGGATATCTTCGGTTTCGAAGAGTTCGAGATCAATCAGTTCGAGCAGTTTTGTATCAATTACGCGAACGAAAAGCTGCA
GTACCAGTTCATCCAGGATATTCTCTTGACGGAGCAGCAGGCTCACATCGAGGAGGGCATCAAGTGGAATGCTGTAGACTACGAAGACAATTCCATGTGT
CTGGAGATGGTGGAGCAACGCCCCAGCGGCATTTTTTCGCTCTTGGACGAGGAATGTGTCGTTCCGAAAGGAAGCGATGCAGGTTTTGCCCGGAAACTGT
ATCAGCGTCTGCAAGAGCACAGCAACTTCAGCGCATCCCGCACTGAACAAGCAGACTTTGCGTTCCAGGTTCATCACTACGCAGGCAACGTGCGCTATCT
GGCTGAAGGATTCTGTGAGAAGAATAAGGACCAGCCCAATGCCGAGCTGTTTGACGTCTTAGGGAAAACGAGTGATTCTCACTTGAGAGAACTGTTCGAC
TTCTTTAAAGCCAGCGAATCAGCGCAACTACAGCTTGGTCAACCAAAGCTCCGGCGACGATCTTCCGTACTTAGTGCTGTTGGTATCGGCTCCCAGTTCA
AACAGCAACTCGCAAGCTTGCTGGATGTCGTGCAGCAGACAGAGACGCACTACATCCGCTGCATCAAGCCGAA