Description :
From Genome Similarity Track
Location :
contig_85:10229- 33149
Transcript NameFunction/comments
g10432.t1hypothetical protein
g10433.t1hypothetical protein

Sequence
22920 bases(100 bases per row)
CAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCC
AGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTTCGGTCGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGA
ACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCAAACTCTTCGATCTTTTTCTTGATCCTGAATGGCCATGCCATCGGTGGGCGAGTTTCTTG
GTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTCTGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGTCAGATGTTGCCCCCGT
CTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCATCGACATTCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGA
GCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGAGATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGA
ATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGA
GTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACC
GACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGA
AGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGA
CATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAACAGTAGTAGGGCTGAGTTACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACC
ATCTGGAACGGTTTTCCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCAT
ATAGTCCAATCCAAAAATAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTC
CTGAATCATCGTTGTGGGCACCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCC
TCGCTAAGCACGAACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACC
ATCTCAGCTCTTCATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTAC
CTCGTTGCTCGATTGCTCGGCTCTCAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGAC
GTTTCATCTGCAAACTGGACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAG
ATCTGTCGCGGGAGATTCCCGGGCTACTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCT
CCGATCCGGTTCAGCTCGACCAATTCTAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTG
CAGCGTTGAATTCTCGGACCACGTGCAAGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTCG
ACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTG
TTCATTCCAGCATACTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACG
AGCAACTGCCATATCCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTG
GGGGTCCATACGAGCAGTAGGTGACCCTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAATCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCT
GAGCAAACGTGCAATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGAT
TTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGA
CCTCCTTCTCGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGT
GGAGCTCAATGCCCACTCATTCGCGAATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGC
GCGCGAAGCTTCGTTTGGCCCGAGAGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGA
ATCGACTGTAATAATTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCT
CGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACC
GTTGGAGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATCATCGACAAACGACCGTCGGTCGAACACTGGCACCAA
CGAGGATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCC
TCGAATTTGGTCACCGAGTTGTTGACTCCTCGAGTTGTCGCATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATA
AGCTCCGAAAGTGGAGCCAGCCGCCTTTGGGTTGGACGAAACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAA
CGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGACGAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCA
TCAAGCGAGCAGAACCATAGGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCT
TGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGCTTT
CAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCG
CACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGG
CTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTC
CGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTGGTATCGGTGTTCCACTACCTGAACCGTCCCCCGGGTAATCTCATGCATCATTGCTACGAA
GGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGACTGGGATGGAGTTCCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCA
CCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACGGGTTCGTCAGAGGGTTGCACGAAGTCGTCAACGGCGTTCGGTCTCGTTCTGTCGGTTCCTCA
GTGCCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGGCCTTCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTC
TACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCAC
TCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGC
AATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACG
TCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCA
TGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACT
CCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTAGCG
TGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGGTCTGGAACTTCGCGCAAGCGCAA
CCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAAT
CGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTT
TGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTT
TACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTG
GCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAG
GTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTA
AAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTC
GGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAGC
AGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTCC
TCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCCACGCGCGTCCACCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCGT
CAGTGAGAGTGACCCTCGTCGATATGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTCGGT
CTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCAGA
TTTTCGCTCTCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGGTCT
TCGCACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGTTGA
GGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACGCATC
GCTCAACAATTTCCACGTGCGTCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCATTCG
TTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGATGT
TTCCGAGTGGGAGATGCGTGCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACAGCGCTCAGCTCACGAATTTGGCGTGCCCATTCTCCCGTCAAG
TCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTCAGATGAGTCATCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCGCTTCGTCCAGCAG
TCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTCGGCGTCACCATGTGAGAGTCTTGGAAATACGTCGACGT
CGCACCTTGGGCCGAAAATATTCCGGCCTCGGTCGACTCTGGGGCGTCTCCCAGGGGTCACTGGCAACGGAATCATGGACGGGTCGACCGGATCCGATGC
GTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGTCCTCG
GGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTAT
TCCACGACTCCACGGGCACAGTTAACTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTCTTCAC
CTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCATCCTCG
GCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCG
CAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTCGTCATC
TTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCGGAACGC
CCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCTTTCTTC
TCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGC
AGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACG
ATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAATG
CAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAG
TGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAG
CAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAG
ACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTA
TATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGGTACGACACGAAATGGGTACAAACGAGG
CTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCCGCCAATCAAGACTCTGTC
GCCGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCACCAAAACCCAACGCCACAGTTTTCATTCGCCATCTCTTTCATTAATTAAACC
CAAGATCCTTGTCTGCCTCATGAGTTTCTTGACCAATGTCCCCTATATCTGGGACTATCCTCTTGTCATTTGGCAATGACCCTGTAGGATTAAAATAATC
TGCAACCTTCCAACGATAGTGGTCTAATACTCTATCCATATTGAAACGTTCAAACAGGCGAAAGTTTTCCACCACGAATAGCATCAAATCTCTTCCACTT
GCCTCGTTGTGATGACGCTGAAACGACCGCTTAATGTACCCGGACATGTATTCTATCGGATTAAAAAAAGGGCAGTATGCCGGGAGAGATATTGGCCCGA
TGTCGATGATTCTCAAAACGTGAGCGATATCTGGATGTCGGTAAATGGATGCACCACCCAAAATCCACACAGAGTACGATCCTGGATGTTGACGCACCTT
ACCTCTGGTAGAGTAGTCGAAGTCACTGCGAATGGCAAACGTGTGCCCTCTAACAGAACACCCCCTTTCCTTATCATCCCGCGATTGTCGTAGGTGCACC
TACTTACGCCCCCTCCGTTTCGCAGGTGACTTTACTTTTATTTACTGTTATCACTTTGGGTATCCTTTGAGACGCCGTGTGCAGCCTTAGACTTCAACAA
AAGGTGAGTCACGTCCTGCAGCTTCTTGTCGTATGCCTCAGCAGCATCAACGGTGGCCGCCGCTGGTCAGACGGCACGCCAGTCTTTATGAATCCACCTA
CGATCGTGCTCTTGACAGCCCATTCCAGCTTGCATGCAGCCATCACACTACAACCTCACGTGTTGGAAGACTCAGTACAAACTTACCACCGTCGCGTTGA
ATCTGTCGAAATTGTTGCTCGATGTCCGCGAGCCACTAGGTCCACAACCGTAGCTTCAACGGGCGCCTCCATGCGATGACGGCTAGTTGGCACACCGATG
TGTAGCCACCCGGGACTTTTAACATCACAGCATTCAGCTCATTGGCGCATAACTCTACCTCAGCCGTCCAGTGTCCGCTGAACTCGTCCAGATGAGGAGA
ACGGGATCGTCGATGTTTGGCTGCGTTGCAAAGTGGAATTGCAAGAATTTCACTGAGAGCCCAGCATCCACCACCCGCGGCTGTTGTAGTAGATCGGCAT
CCGGTCGATGCCTGCATAGCTTTCACTTTCTTCCACAGGCCACGGCCAAAACCTTGCTGCTCCGCACGATGGTGAAGCTCCGTAGCCGGCACTCGCGACG
GTGGCTACTTGAACACAAGGAAGAGGACTCGCTTGACTCCTCTTGAATCAGCAAGCACCATCACTGTGAGGCGGCTCTTCTCTTTGCCACTGTTGCGGAC
CCACTCTGTTCGGGTGCCGGACTCGTCAATAGTAGATGCTCAAAGTTGAGAGCCGTCTGGTCGGTGTTGTAAACTTCCGTGACGCTGTGCTTCAGCATCG
TCTTCTGGACTTTCTTGCGGTCTGACACTTGGCGAGAATCGCTGGGTGTTTGCTGCCCGATCCGGGTTCGTCGCCGCAGCGAGAGCCTGAACGACTTAGG
AAACGGCGACGCCACGGCGAGCTTGCCGAAAACTGGCCGTCGCGGAGCCAATCATGGCGGCCACAGCACGAGCCTTCATTTGCAGCATCAGCGGTGACGC
TGTTACACCTTCCCGCGTTAGGTCTCGACCCAGAAGGCTAGGCGGTCCTCCGCAGCCCGAGGCAGAGTGGCAGCCTACGCCGATCGTGGCAATTTGCACA
GGTGTCCGTTGCCGAGCGTGACTTGCTTTGCGATCTCTGCACTCTCCTCAAGCCACTTGTGAAGCTGGTGCTTCGTACGCTTGCGATTCGCTGCTTGGAG
AGGCGGGATGAACCGAGTTACCGCTGCTGCCATGCGTATTTATCGATGTAGCCATTTTATGAGCGCTTGCGCTGGTAACTGACAGCCGTGCGCACATACT
GGGGAGTGAGCTCTGGAACCCTTTGATGCGGGGCGGCCTTCTCGCGCATGCGTTGCTGCCCGTGCGCTCGAAGAGTGAGGTGCCGATGAATGGCTACGCT
CGTGGCTTACGAATTGACTGGTGGTAATTATTCGGAGTGGCTTTTGACATGACATGATATATGACCAAAATAGAGCGATCTGATAGGTTGATATTTTTAG
AACCGTCGCCTGCAAGGGGTGCCTTTCGATAAGGTTTTTACGGCATGGCCACACTGACATTCCTGCACGAGAGTAAAGTTTGTTGACGTAATCAATCCGT
GGCAACCTGTACTTAAATTCAAGGCGGGGCATCTTGGCATAGAAAATCTAGACATCAACAACATGGAGAGAATCTCACGCGGTCGAGATTGTGATAGCTA
GCATCCAAATCTGGTGACACGACAAAGGCGAGTAGCATGCACTCACAAAACGACGAAACGAACACGAAGAGCGACAATGGTAGTGTAGGACAATCTTCGT
CTTTTGGATGATCGAGATTGCAGTAACTGATTGTTTGAGCGGTGAGGCCTACAATCAATATACAATCTATATTTCCACAGCTCTGCCACGAACCAATTCA
TGCTGCCACGAAAACGATCATCTGGACAGCGTGCTCGAACGTTAGGGGTCACAATTGTGTTCGCCCTGCCATGAGAGCTGCGACCATGAGCTGCGTCTGA
AATATACACCACAGAATCCATATTAGCACACAGTTGGCACACCACAGCAACCGTGGCCCGTACCTTTGGGTTCGGCATCGCCACCAACTCCAACACGGCG
TTGATAGGGGTGAAAACCTCGCAATGACCGCAGCTAACACAGCGTAATTGAAAAGCGCGCTTCGGTAGAGCAGTTTGTTTTCCCAGAACCCTTCATGAAT
GGCTGCCCCCGATAGTTGGCCACGAAGGTGTTCAATTGCAGATCGACGACATGAGAAACATGATGCTGTTGACCATTCGGGTGGAAGTTGCCATCCGGGT
GCATCGCTGGATCTCCTGGCTCAATGAAGGGTTGCGCCACGCGAAGAGCTGCCGCTAGAAACGCTAGATGGATCACAAACTGACCAAAGATCGACACCAG
CACGGAGATGCAGAACACTCCAGACGGCGGACGCTGATGCGAAAGCTTTCGTGCGGGTTTCGCACGAGAAAGAAACAAGAAGAACATCGCAATGGACAGC
TGGACACACACAAACACCACATCATTAGTAGTGTTCGACTCGGGAAACATGGCGCAAATACACTCACCCCCGATATGGTGAGCTGCTGATCGCCATTTTT
CACGCCAAGGATAAAGAGAGAGCTTAGGTAGTACGCCGTGATTAGACAGTTGATACCCAGAATCTTGTACATCTGGATCGTAGTCACCAGCGTACATCGT
CCCTGGCGGATCAGTTTCTTGATCACGCGGATACTCGAGCTCTTGGAGGTGAACGGAGACGCGATGGAAGCATCTCCCAAACGCACAATCTGAACATCAT
CGTTGGTATACAAAGACTGCTGCAACTCTTCCACTGAGTTCCCCCTGCTCCCAGGGTGTCGGCGGTGGCGAAGACCATTCTGAGCCGTAAATCTCCCCGC
GCCTCTCCCTGCGTCAACCACATGAGGGGGATTCTCGGAGCTGGACGAATTCACAATCGAGATACCGATGTGCGCTTGCTTCAAGGCACCCACGTCGTTT
GTACCATCTCCGCACATAGCTGTAGTCTTGCCGCGCCGATTCATCGCCATAATGAGATGCTCCTTTTGTTGAGGTGAAGTGCGAGCAAACACCGTGATGC
ACAGACAAATCTTCCCAAGGATAGCGAGAAAGCCCTCCAGCGCAGCCGCACTATCGCTGCACTTGTCTTCCTGTTGCTTGTAAAGCATGGCTAACGCTTC
TCCGGTCACACACATATCGTACTGAACTTGCATCTTCTCCACTCCGTCGACATTGAAAGGAATAGTCTCCTCCTCGATGTCAGGTGACCCGTCGTCGATG
GACTTCCACTCCACAACTCCACTCTCAGTGTTCGATGTCAATACCAATGGCTGCTTGGAATATTCCGAGTTAATCCCAACTTGCCGGGCGACATCACACG
CAGTAAGAGGGTTGTCTCCTGTGACCATAGTAACTTTGTGCTTGGAGATCATCAGCTCCCGAATTGTTCGCTTCGTGTCATCCTTCAGTGGGCAATCCAT
GACCAGGAATCCCGCAAATGTTAGTCCACCTTCCAGCTCACAACGCGGCTTGCGCCGTAGCTCTTCTGGGGAAATTGCTACAGGGAGGACGCGAAAGCCT
AAAGCCAAAACGCGACATCCCTTTGATGCATAGTGGCGGTAAACACGACGGTAGTACGAAGGCTTTGTACTAAAGATCGGCTCGAGTACTTCAGGCGCCC
CTTTCGTAAGCACCCGCTGCTCGTCTTGCTCATCGTTATCAGCCTTTCGCACAGTTACAACGGTGGTCATGCGCTTGAGCTCCGAGGAAAACGTGAAGCT
GTGCAAAATATCAACAGCTTGGATTTCTCCCCGGCGATCAGAAAAAAACGATGGTTGAACACTTGGGAGTGCTCCTTCTCCATCTTCGTTGTTCTCCAAA
CACCACTGAATGCTTCGAACAGCCGTCATTTCCAGCGGGTCTCCAGCAACTTGGCCATTAAGCAACACCAATGACTGACAACCAGCAAGAACGAGCTCTG
TATCTAGAGGAAGTTGCTCTGGTGCAATGATATCCAGCTCGCCCCGATGCTTGCTCCTGGACTTATCAGGCTCAACATGTGTCTCCAAGCCAGCCACGCC
GTGAAGCTTGAGTTCATCGCTGGTTAATGTACCAGTCTTATCGAAGCAACAAACATCGATGCGCCCCGCGAAGGGGATTCGAAACGGCTCGGTGCAAAAA
ATATTACTTCGCGTCAGCGCGATCAGCGAGTTGGTCACTGCTAATGACAGCTCCATGGGGAGCTCGGGCGGCACGACAGACGTGATGATCATAATACAGT
GAAGGAACAGTTTGAACTGGTTGCGTGTCGGATCATTTATTCCTTGTGCGAGCACAAACGCGGCTGCAGCCACGGCAAAATTCAGCAACAGAACGATAAA
CCACATCGCTTCCGAGTTGTTTGCAGTAACACGCTGCGACGAGTACAAAATAGTCCGCATGAGACTTCCTTGCGTCGTGCCAAATCCTGTCCGGAGCACA
AACCCAACGCAGCCTCCATCAGGAGGTGTAGATACACGCAGCGAATCCTTCGAAACTGGTGTAGTGTGCTGAAGAATTTTAGTGCCCCCATACAATACAT
GTCTTTTGTGTTTCATGCTGGAGCCATCGTCAACCTCGAGATTCTTTAGTTTCTCTGCATCATTCACAATCGATGCCATCACAGCCTCCTTGCGCAAAGG
AATGGATTCGCCAGAAAGCATGGACTCGTTCACCACACAGTTACCACGAAGTAAAAGCAGATCACACGGCACTACCGGTACGGTACCGCGTTCATGGTGC
CCAATAGAGCAGATATCACCGGGAACCAGCTCGTCACTTGACACCTGGGTCCACGTGCCCAACCGGTAAACCAGACACGGCTGTGGAGCGCGGCGCATGT
GCAGCAGTGTGTCCATGTTCTGCTGGCGCTGCTTGACCACCGTGCACTCGAAGATCACGAGCATGAGCAGCGTCAGCAGCGAGTAGTACATGTACTCGTC
GAGACACCAGAGCAGCATGCAAAAGAACTGGAACACGAAGAACGGCGCCACCAGCTGCTCCTTCAGCAGCTCAGTGAAACGAGGCATGGGCAGCTCAAAG
TCGTTCCTTCCGTACTTGCCTCTCGCCTGCTGCAGTTCATCACTCGACTGGATGCCTTCACTCTGCAGATAGGACGCCAGCGTGTCGCTGGACGGGAACT
GCAGCCGACGGAACTGCGTGTCGCTGTTGCTGTTGATGGTCTCCACGTCCTCGTACAGACAGAACTTGAGGTTTTGGTACGAGAACCAGAGCGTGGGCAC
CTGTGCGTCCTTAAGCTTCTTGTCCTGGCGGTTCAACTGGCATTCGCAGAGCTGCTTGGGCAGCATCGAGAGTGACGGGTCCACCTTGGCCAGCATCTGG
ACGCGCTTGTCCTCGACCACCGCCTTCAGCCGGACGCAGCTCATCCAGCAGCGAACGTCCACGCTCCACTCGGTGCCCAGCAGCGCCAGCGCATGACAGA
AGACGATCAAGGCGCCAAAGACCCACGGAACAACGTCGTCCTCGGGCCGCAGCGTGTACAGATATGCGGCCGTGGCGTACAGGAAAAGAAAGGGCAGCAG
GTCCAGCCGCATGAGCCACGGTAGCGGCGTGTACAGCGCGACGGACGCGAGCTCCGCGTCGGCCACGCCCACGGTCAGGACGCCCATCGTCACTTGCGAT
CCAAAACCGAAAATGAAAGGAACGCTAAGTACGGAAAAGGGCAAGTGCAACGTGTCAAACAGCGAGATGGCAGCGGAAAGGATTTTTCACCGTAAAGTAT
ACAGTATTGTGCATTTGCTGCATCTCTTCATACGGAGAGAGGAAGTAGGTTGTGGAAGGGATTCGTCAGATCATCGTAGTCTTAAGAGTTTGTGTTTCGT
CAGCTCACACTTGTGTGCAAGGTCCGAATAACCAGATAAACAATCATCACTCGATCCCAATGGTCTACAGCTGCAGCAATGTGACTTGCGCGGGTGGCGT
TTTCTTCAGGGAAACATGGTGTCCTCATTCAAGTCAGACATACGCTTGTTTAAAAAGCATCAGCAGAGAGCCACCACCACGCAAACGGCAGCAAGTACAA
ATGATACATTTCTACAACTATTCACATGAAGCACTGTCTGGAGGCAATGCACAATACACAGACGTTTGCAGCGAAGCCTCAGTTGGTACCCGAAAAAGTT
GCAATCGACATGAATTGGTCCGTTTGGTGCAATATAATCACTGGCTTTAGCAATCGATGGGGACAGCAGGAAATTGCATTGGGCTCTGCGCCGGCGAGTT
TAATGCGCGCGCGACGAGGAGCAGAAGCAGGAATGAATAAGGCGAACGTGGCGGCATCGCAGCCGCGAATTGGTTGGCTGGCTATAGAACACTTTTTACG
TCCGTAAAAAGGTAATTACGCAAACTCACATCTATGTGCGTCACATCAGCCAGATGTTCCGTACACCATGAACGATTCATACAAAGGCCAAGATATCGCG
ACATACCATACAAAGTCCAAGTGATCCGCTGGATATCCTTGGAAATCAGATCACGCGCATTCCCCCACGAGTCATGGCGCTGCCCCGCGGCGACGACGGC
GACGCGGAGCTGCAGCAGCTCAAGCAGAAGCTGGATCCGCTGGTGTTCGGACGCGATGTCGTGTCTCTGGACGAGCGCCTGGTGCCGCGCGGGCCAGAGA
CCACGGGCTTCGAAGTGGAGCCGCCCAACAGCAGCTCTTTCTACGGGGCGCTACCTGCCGACGCGGAGGATGAGGACGATGAGGACGACGACGTGGAGAG
CCTCGAGGCGCCCGTGAACCGCTACGCCGGCGTCATCTACGCCGCGCGCTTCTTCGTGACGCGCGTGGGCTTCCTGCGCTCGGCCAAGCGGCTAATGGTG
CTCAGCAGCAGCCATTTGACGGTCGTGGACCCGTACTCGGACGAGGTGAAGGAACGTTACGCATTCGACAACATCAAGGAGATCACCATCGCCTCGGACA
GCGGCGGTCACAACGCCGACCGAGCCTTCACCATCTTCATCGGCAAGAACCTCAAGGAGACGTACACGTGTCGGTGCAGGCAGCAGCTGCTGTCCGCCTA
CTACCAGCTCAGAGAGCGCGCGTCGTCCTTTAGGAAAGATGAGATCGATGCAGCTACAGCCGACGCTCTGAGTGCCGTGGGCGCCAGTGTCGGGACAGGA
GACAACAGCTGGGCCACAGGATCCGGAGGACCCGGCGGAGCAGGCGCAGCGAACGCCAATATGCTGGGCAGCGGCATGTACTTTGACAGTTTGTTCCAGC
TGTGTGGCAAGACGTTCACGATGACAAAGCTCAGCACGACGCGCAGCATTGCGATCCACCCAGTGAAGGTGGATGTGCTGCTGGCTGTACGAGCCGCGAG
CTTGGATCGGTTGGACCCGCAGACGCGCACTACGCTGTCCTCGATTCTGCTCATTGATATCGTCAAGATCCAACGGATCAACACCAACTCCAACGAATTG
GTGCTTTACTTCGAGAACAACCGCGTGCATCGCTACTGGTGTGACAGCCGCGAGCCGTTTATTCAGGCCATTGCGAACAATTTGCGCTCGTGGCTGAGCG
TGTCGCTTTTCGTGGAGGAGGTGTCGGACTCGTGCGAGTTTGACGCACTCACCTCGACGAGGGATATCCCACAGCCTGTCACATTCGAGATTCCTGTGCT
GAAGATCAGCAAGAATAAGTCGGACAAGTTGCAGCTGCGGTTGCTCGGTCTGACCGCGTTGGCGATCATTGAACGTGACCCTGTGACGAGGAAAACACTG
GCAAGTCACTCGTTGAACGACATCTTTAACGTGGTGGTTTACCCGTCGGTATCTTCGGCTCAGGATGACCCCGACAGCGAATCATCCGGGGTTGAGCGGT
AAGTTTGCGCTAGAACTGAAGCATGGGCTGACACGTCGGTATCTCTGTCTCAGCTCAACGGTGAGCAGGCGCGATAAGGAGGTGAGTCTTGGATTGAAGC
GAATATCATCGCAGCATGAGGATGAGCTTCGCCAGATCATTGGAGATATCGCTGGAGATGTGAGCGTGCCTGAATGGTTAAATGTTGCTGGATCAACGAC
GTTGCTTAGTCCGAAAGAGGCACGGAGTTTGTTCCTAAGCAACATGATTGAGATGTGTCGAATGAACAAGCTGCACGTTCCGTGGTCGACAGAGGAGACG
AAAATTGCATGCAAGGAAGGAACGTGGGGTACAGAGGTTCACCCTGAATGGGAGGATATTCTGTTGCGCAAGCTGGTCAATCTGAGCTTTATCCCGAACC
TCGTGACGAATGAGAGCATGTCGCTCATCTACTATCAGCTGGTCCAGTTTAATCGCAATATTCCGTTGGGAGGTCTTCGTCAGCGCGATCGTCGTGCATT
TGCGAGTCTGATGAGGCTGCTCGAAAATTTTAAGGACTATTCTGTAGCCCAACTCAACAGCCCTTCCAACACAGATGCACCGATTCCGACAACAGAGTTC
CAGGTGGAGCTGCTATTGGCAATCCAGCGCTTGCTTTGCACTCGAGGTGTCTTTGAGGAAATTCCAAGTTCACAGTACAAGAACAGCATTGAGGTCATCA
TGGAGCTGCTTCATTCTCCGATGGAGGAGGTAAGCTTTGCGGCAGCGTGTGTGATTAAGTACATGGTGGTCAACTACTCCGATACGCGCAGCTTGAAATC
CGAGACGGCCAATCGCCGCGCTATATTCACGAAGTATCACAGCAGAATGTATGTGTCTCGGGCTTTCGATCTGTCCCGGACAAATCGGGTAGGACGGATG
CCCTTGCATTCTGCTTCTTTGGTAAAGACAGGGTCGGGTCATGGATCTCTCACAGTAGCTGCAATGTCCAATACTGAGCGCAGCATGGCTAATGCGCTTG
CGTACTCTCAATTGGGACTAGATTACCTTGTCCTTGCTATGGTACTGCAGACACTGGAAGTTTGTTTATCCAGCGGAAAGAAGGCGACTCCTGAAAGAGT
GGCAAGGGATCTACTTCGAGCCATGAGGGTTGATGACTTTTCTCGCCACCATGCTCTCTTCTTATTCAATCGATCTCTAAGCTTCTCGATCACGAAGTGC
TCCTCAATTTTGGTGAAGGCGCATATTTTGGAGCAGCCCACTGAGCTCGTCGAGCTGATTCAGGATTTTGCACGGAAGCACGGGGCGCTCGTGTGGCAAC
TTTACTTGGCACTGTATACCCAAGACAAGGCACAGCGGCGGATTTCGTCCCAGCTTGTGGCTTTGCTCACACATGAAAACCCGCGTTCATCTTATGTGGT
TCGGAATATTTTTCCACACGCGTTGTTGGATGACCTGAAGACCAGCCAACTAGAGTACGACGAATACGGCAGACATCTTCCGACCGCAAACCCTGAGCTT
TACGCGAAAACCAACGGTGGTTCGCATAAAAATGGGGGCCGGCGTGATATCACCAATGCAACGGAGAGTGGGCGAAGCAAGCTGAGCTACGGGATCAACA
CGCGAGGTCGCTTGGCCCGAAACGTTAAGTATGCCGTGCTCTTACCAGAATTCTTTGACCGTCTGGGTAAAACCTTTGCGACCAAGGATCTTGTGTGGGC
CCTAACGCGGTCGAAGAACTGATTCGCAAGCTGCAGGCAGAAATGAGTGATCTGGACTTGTATCGACTGAAGTACTTGGGGTATCTTTACACGGACCCGC
TTGCGACTGATCACACGGAGACTGAATGGGATGCGTTCCAAGCAAATCGGCTTCGCCACAACGATCAGCAACACGCCAATTTTGCTCCGTTTCTTTTTGA
GTTTTTGCAGAACGGTTCCGAAAGTCGACTGGCGATTGAAATGTTGAAGGGAACGATATCGTCATCCAATCGATTCGCGCGGTTCATGCCTCTGTCGTTC
CTGCTAAACCCTGACACGTCAGGCGACGTCGAAAGTGACGGCGGACTGGATGATGACAATTACGACAGTGACGACAACTACACGGAAGATAACGGGTTCG
TATCTCGCTCAAACAGTATCGTACGCACCGGAGATAACCCGGAGACCAAGCAAGACGACCACGATGGATCTCACGACGAGTATAGAAATACCACCTTGGC
CAAGAAGAAAAAGAAAAATGCGAAGAATATGCCACGGTGGTTTGTAGCTTGGAATTGCAACGAATTCCGCGTGGACTACGAGTGCCTGGAGAGCGAGGTG
AAGGTTGGCCCGTATTACCTTGCAAACATTCTTGACGATCGTGGCGTGCTGGTAGAAGATATCGAAGGTGCAGAGAAATTCATGACGCTGCTGTATTATC
GTCTTCTTGCCGAAGACCGTAGCATTTCACCCAAAAGCTTCAAAACGGGTATTCTTCGTCGGATTCGCTGGGCGACGTCGACCAGTTTGATATTCGTTTG
CTAGTTCTCAAGGTCATGATTCAGCTGTATGAGCGTCATTTCAACGAGTTGGGCTCTCTGATGTTCCTAAACCATTTTCTCCGTGCCAGTATGATGAAAA
GCCGAGATGGTGAGGATCGACGTTGGCCGTTAGTGGTCCGTGGCAATATCATGCTTTTCCTGGATCGCGTGTTGTCGAGTGCATTGAATGTGTCGCGCTT
CTTACGTGAAGGCAACAACGTAACAATGGTATTGGATTTGCTTCGTGAAGTGAAGCCGCTGGTGGTTCTTCAAGGACCAAACGATTCTGAAAAGGAGTAT
ATCGTTGAGCCTGCTGCTGATGTTCAAGCAGAACTTGATGCGTCTGAAGATGAGAACGAAGCTATCGATGATGAAGACGATGACGATACGGTGGTGACAG
AGGTGAGTACGACGACGACGACGACGACGACTACGACGACGACCGGGATATGGCGAAGAGAACGATTGATGCGCTGGAAGAGTCTGGTGCTGAAAGCTCT
ATTATTTCGAGCCATTCTATCTCGCCAACTTATGCACACCGCGATGACGAAAGCGTCCACGAGGAAGAGCCCACTCGCGTGACAGTCGTGGCAGAGCATT
GTGGTGCCATGAGTGGGTCGATGATTATGCAGACCTGTTTGAGCGTGCTCAGTCGCCTCATCGATTGCCATACCGCCGAAGAAGAAGGGCACATGCACCA
GGATGTGCGTTTCCCCAAATACGGGCGGCTTACGCACTTTGAAGGTTCGGGTGTGAGTCCAATTAGTTCTATCAAGCACCGGCTGTGTGAAGATCAGACG
CTGCGGTTCTTGGTGGGACTCTTGGATTGTCCGAATCGCATTGTTTTCAAGAAGTGCCTCGGATTGATTCGACTTCTTGTTAGGCACAACGAGGCAATCA
TTCCGAACCTACACGCATCCGGCATCTTTTACTATCTGCTTCGCTTTGCCCAGGATGTGGACGAAATGTCGATTGCGGCGCGTCTTATTTCCCATATCCA
TCTGCGCCAGTCAGGGCTTGATGTGCCTCACCTGATCGATGACAAGCAAAAAGGAGAAAACAAGAAGGGCGTTTTCTCTCCTGATCCATTAACACGGATC
TGCTTGAGAAGTTGGCTGGTACGAGTGCTGCCAGTTTCGATGGTTGCTCAGCTGCTCCGTCATGGACCACGACGGTTTGCCACTGCTCTTTTCTCGGACG
CAAACAACCCAGAAGTGGTCTGGAATGCAAACATGCGCAACCAAATGGTTTCCTATATTGAAAAGTTTATGGAACGTCATACAGATGAGAACGGCATGTT
CTACATCTCAGAAAATGAGGGCTCGGAACACAAGGCCTGCATCGCGCTGATCCAGTACCCGAAAGAAGTTCACGCATTGCAGTGCTACCAATACTACCTG
CACAATCTTCTTGATGAGAAGAATTTCCCTGGGTGGCCGATCAACGACGAGGCTGCATTCTTGCGCGCTCTGCTGGATTCCATTCGCCGCTGGGTGCACC
CAGGGCTACTATTGACTGCTCGTGGGGCGATGGCAACCGACGGTCAGTCCACGAAGCTCCTTTCAGTGTTCGATGCGGTAGAGCTGCTCGACGCCACAGC
ACTGCTTCTACGCCGTTTCCCAGACTCGCCAAGTATTACCAACTTGCGCAACTTCTCTTACTTCCTGGAAGCCCTGGAACGATGCATCACAGAGTTGAAA
GACAACCGCGTTGGCCCGACGAAGACGTTTTTCGACGTGTCCAATGCTATATCAACAAAGGCTACCTTCGTTAAGGCTTTTGGAAGTGCGATTCGTGTGA
TCAATTTGGCCGTTGGAATTTCGGACGAGAACGCTCACGAATGTAGCTCCGGGTTGGGGCTTCGCGTGCTGTGCAACTCACTTCAGTTGCTCTTCCACAA
CCAAGAAGCGCTGAGTACTATCGATGGTTGTACGCCAAATGTGATGACACACTGGGTGCTTGAAGCACTCGTGAATGTGTTGAACCAACCTAATGGTCGA
GTATCGGCCGCTGCACAGTCAATCGATTTGCTACCGTGTCTGACACGCTTCCTCTCGCAAGGAGGCGACCGTCTGGCCACGGATTTGTCCCTGCAAATTG
TGTACGAAATGGCTGGAAGCTCGGGCGAAATGGCAGAGGTTCTGCTACTGCAGCTCGCGGAGCACGGAATCCTGTGGTATTTAACGCTTCTGTTGTTTAA
CTACCAACCGAACAATGAAGATAGCGACGGAGACATGCAACGCATCAGCATTGGTGCAGCGAAGGCATTGGGGCGAATCCTGGAAGCCAACGCGAAAGAG
GAATCAATTTCTGTGTTTGTCAAGAGAATGCAGACTACGATCGAGCAGGTCTTTACACGCCCATTAGTGGACATCTTGCGACGAGCGGGGCCGGTTAAAA
TGTTGGACGTGCTGGCAACTGAAGTTCGCGAGCCGCACGTGATGTGGACTGAACGCATGCGCAAGGAGCTGATCAGTCTCGCTCAGCGTGCGATCCAGTT
CCATACAACACTGGATCAGAGCGATGAGGAGGTGCACAAGGTGTTTGAACTGCCAACGTATTTCATGTACACGGCACAGAAAGAAGAATTGTGTGTGGCT
GGCATCTACGTCAACTTTTTCAACGAGAACCCGAAGAACGGTATCCTCGCCCAGATTGCAGGAACTGTGAATGGCAATGGAAATCGTGCCGACATGTTTA
AACCCAAGCCGACGACAAAA