Description :
From Genome Similarity Track
Location :
Scaffold_19:10228- 37690
Transcript NameFunction/comments
Phyag_g547hypothetical protein PHYSODRAFT_505018
Phyag_g548hypothetical protein PHYSODRAFT_505033
Phyag_g549ATP-dependent RNA helicase dbp4, putative
Phyag_g550hypothetical protein PHYSODRAFT_510256
Phyag_g551hypothetical protein PHYSODRAFT_510279
Phyag_g552hypothetical protein PHYSODRAFT_561505
Phyag_g553hypothetical protein
Phyag_g554hypothetical protein PHYSODRAFT_354820
Phyag_g555hypothetical protein PHYSODRAFT_302198
Phyag_g556hypothetical protein PHYSODRAFT_507552

Sequence
27462 bases(100 bases per row)
GATGGAGGCTCAGGGCATGACGCGcatgcaggagctgctgagcagctACTACGGCCTGCAGGACCAGGAGAGCAGACAGGAGCAGCTGCGCAACATCGAC
TCGCCCGGCTTCGACTCCAAGATCTACGTCAAGGcgcgtctccacctcctaGTGTAACCCATAGAGTAACCCCCCTAACATTATGCTATATTTTTATTta
tctgctgcaggagctgctggaaaccCGCGGGCTGAATGATCTACTTACGACAGACGACCAATTGATCCGGGAaatcaaggagctggacaccAGTATGCAG
ATGCTTGTGTACGAGAACTACAACAAGTTTATTAGCGCCACGGACACGATCcgcaagatgaaggtgaTCTTTTTTTATATAATTTCGAGGGGAATGCTGG
CCAAATTTTATTTTTTCCAGTATTTTTACGATAATCTTtatggctgctgcagaataaTGTGGCGAGtatggaggacgaggtgggACGGGTTGTCAAGAGT
ATGGACACGATCACAGCCAAGAGTGAGAGCATTAATGTGGCGTTGGCGCCACACCGCTCCAAAGTGGAGAAGCTGATTGGCGTACGCCGACTGTTGAAGA
GATTCGAGTTCATCTTTGAGCTGCCTCAGAGACTCAATACGTACGTGGATTGGGGTGTTGCTGTGAAGGAGAGAGGCTAATTGTGAAGGTATAGTGCTGT
GAAACAGAAGGAGTACGCCAATGCTACCAAGTATTATCTGCTCGCACGTCGGATTCTGGGGAGATATGAACATATCTCTTCGTTTAAGGTGGGGATTGAA
TTTTGTGTTGTGATGGCGATTTCATTCAACGGTTCTGAGTATTCTCCTTGCAGACGATTCAAATGGAAGCCGAGAAAATtatgcagcaacttgaacGCTT
GCTCAAGAAGCAAATGCTTGACACGACGCTGGAGTCGGAGGAGGTAATTGGCCATCCTTTCCTTGTGTGTTTTTAAACGTGTCGAGCTAACGTTGTTGTT
TCGTGTGGGCAGCTCTGCGAAACCGTAgtgcttctgcatcaactaGATGCCTGCACTGATGATATCCGGGATCAGTTTCTCGAGTGGCATCAAGCGTACT
TTGAGCGTGCGGTTGCAGTGTTTAAGGTGCGCTATCTTGCCATATTGCATCACTGTTTTTTTTATTTCCGGCTACGTGAGTCTAACTTCAACCAATAACC
TTGTTCGCTACAGACTCAAGGCACGGCCAACTCGATGCTTGATTTCCTACAAAGGTTCAATGCGGACGTCTTGACCAAAATGGGTCGAGTATTCTCAGTT
TACAAGACCCATTTTATGCCTGAAGTCGTCGCACGCGAAAAAATGTCAGCATCACGAAAGTCCTCCGATGCAGTTCGAGATGACTTGTTCCTCAGCTTCG
TGAAAGAACTATTTGCACTATATCTTGGCGAGTGTGTCATCCAGTTCCGTCGCCCGCATACGGATTTTGTACGTTTGCCGCTGTTATATCAATACTTGCC
TATCAGGACGCTTGGTATTAACTAGTGGTCATCGCTTGTTCATTTCATGCAGGGATCTACGGAAGAAGTCATTGATGTGCTGCAGGATGATGACCTGTCG
TCAGAGATGGTCGAAAGCGAGTATTTTGTCTTCATGCGAGTCATGAAATACTTTGTTTCACAAGTGAAAGACGTGGATAGAGACATCCCGATGTGTGGAT
TGGCTGCCAACGCCACTGAAATCGTGGAGAATTGCGTGCGATTCCAGATTGAGGGTGTATTTCGAAAGCTCCGCGAGGATACTGGTGAACTCTTTGTCAC
TTCTCACGAAGATGTGTGTGCCTTGGGAAGAAGCTCGCGGGATGGTGGACAGAGTGTTCAACCCTTAGCGCAAGAATCAGCGAAGACATTCACCGACATG
ATGCAGAAGGTTCTGCGGCAAATGGAGCCCATGGTGCAAACAGGTTTTGCGATTCTCTCGGATCTAAGCCGACTCTTTTCTGACTTAGTCCAGGTAAGAT
GCTGATGGCGAAGCGCAATAACGTGATTATTCCTAATGTGTGCGTGttcgaacttctccaggGCCAATTTTACGATTTCCTGAAGTGGTTTAATTCGTCG
GTGCTTCAATATGCAGAACCCAAGCGCGCGTTTACTCAATCGGGCGGAACTCGGATCGAAGACCAAGACACTGTAACGCTTCCGTGGCTTGAGCCTACTC
CGCAATTCCTATTGTTCCTTGCCTGCATGTGCCAAGATCTGTCTGCTGAGGGTATCGGCGAGTGTGTGCGTGGCCTCATTGAGTGTTTGCCAGCACCCTT
GTCTCCATCGAAAACCTCCGGCGGAGAGTCGATTCGCAGTCACCGAATGCACCACCAGGACGTAACGCACATGATCGTAGTGACTCGCGAGTCTTCTgcg
gaactgctgcagcatgttGCTAAGCAGTACGGCAATCAGTTGTGTATCATTGTCCATAACGGGGTGGCTGCTACGTCATGGGTTgacatggacgaggagc
CGAGAAGTGTGCAGGAAATGATGGCTGCAGTCGTTGAGGCTACCTTCCGCTTTGGAAAAGAAGTCGCGCTAGCGCTCGGCGACGAACAAAGCATTTTTAT
CGGAAACAACAGCCGTACGACAAGCCGCGATTTTCGCCGGCGTGCCAGTGCGCTGCGGTCTCGCAATgcaggagttgctgctgcatcgtctGGTATGCAG
TTAGATGTGGATCGGATCTTTGCCCGCAAAATCCACATCTTTCCATCCCAGCTAGAGCTTACAGCAGATGCATTCGTTCAGGTCATGCTCAAAACGTGCA
TTAAGGCCTTCAGCGAATGGGTGAGGTTGCTGGAGTTGTCCAAGTTCGGATTGCAGCAAATTCAGTTGGATGCTGAGTTCCTCCGCAGCACACTGATGCA
TATTGTGGTGgctggtgaagctgaagaggaagtggAAAGTCTGTTGTCAGACTTACTTTCGAatgctcgcgctcgcgctgTCGAGGATGTACTCATGGAC
AAAAGCAATGTTGTCGCCATTGTGAGCACCAAGAGCACACAAGTTCTCTCACGCCGAGGATGATTTGGCGCATCACGGGAGAAAACCAGGATGACATATT
CACTTATACCTAACATTTGTTTGTTTGCCTGCAGCGCATGTTGTTCAACATTTTCTGTCATTTGTGGTGATCAGATAGATGTCTTGTGTTTGGAGCGCGT
TGGTTGGTTCAAACATTTGCTGGTTCTTCAGTTTCCGTAGCCTCACGCACAAGTTTGTCCAGCTCAACTTTATAACGTCCCCGGTTTGATTCCAACGAGT
CCGCGTATACGCGCACGGCTGGACACAGAGAAGCAAGCGGCAACCAGATCGGGCGCAACACATagttgatgaagttgagctGAACGGTGACTCGGGTCAT
CGCGTGGTCCAGATTGGCCATGAAAGAGTCGACAGGAACGTGAAGTTCAGCCTCGTTCTtggcttgctgctggtattCAGCGAGTACACGCGTGCCCCAA
CGGACTGCCTGTGCGTACGGTAGTGCCTGACCTGACAAATCTGCTGCATGGATGATTATTGCCATCAAGAGAAAACGATGTTTTCTCCGGCCTTGTTTCG
CGCCTCTGCCTCCGTTGttgacaagaagatgacgttTGGACAGCCCTTCCAATGCTTTGCACTTTTCAAAGTGCTTAGCCATGTCTGTCGCCAAAATGCA
ATGAATAAGTAGCCGACGCACGTACACGAAGCATGCGCGTGTGGGCAATCGAGCCAGAAGGTTTGCTCCAGGGTGACTCAAAATGATGAACGCAACACGG
CAATGGTGGCGTTCGAGCactgcgtcgtcgttgtGTGTGAGTGCGAGCTGGCTATGCGACTTTACCTCGAAGTCGTTCGTGTTCCCGGGATGGTCCAAGT
CATGACACAGTGCGGCCACAAGCATAGCGAAAACTTCTACTCGTGCGAAGTACGAGTGAGCTACACCGCTTCGGCGGAGAAGACAATAAGTCGTGTGCGT
GACCTGGAAGGCATGTTGAAGGTTGTGGTAGGCGTTGGGGCGGTAATGAGATGCTACGTGGGAAAGAAATGTAGAGAACGTCTCCGGCCCAACTTGAAAG
CGTTCCAGCAAACCAAGCGACCGGAAGAGCACAGATGTTGCTGCGAATACATCAGCGTTGGATAGGTCCAAGCAACTAAAGTCCCAGCGCGTCACATCAC
CAACGCCGATCACGTGTCCATTCTCGCGTGGAGTTGAAATTCGTCGCTGAGGAGACGGAATAGCAGCAATTGGCGTGACAtactcgtcttcatcctcagT
ATCGCCAGCATCGTCTTCATAATCGCTGTCGTTTTCTACTTCGACATCGTCGGGATCATctgcaatggctgcagctgctaccccctccagcgcgtccagc
tcaCTAGTTTGGCAGTATTTTTTCACGATGGACGCAATGATTTCAGGTTCATTCACGTCGTcggtttgctgctgttctttgGAATGGTCAGCGGAGTCGG
ACAAGGGCTCACCCGGTGTACCAAGCCCACAATCTGAAACCACCTTGTAATACGAGATGTCTAAGGACAATCGACCGAGCGCAAATTGGATTTCTCGGCA
GTACTGGGCCATGGAATCAGCGTCGCTCACAGTGAACGGCACGCGGTGCCTCACCACGGGAGGGggatcgtcgtcgtctgaaTAGTTTTCcccatcgtca
tcgtcgtcttttTTGTTGATGGCCATGACTACTGCTACGATTTTGGGGTTGGTCGGTGCGTGATCCTCGAACACGGGCATGCCCAGGACGGTTGTGGTTC
GATACCCCGTCTTGCGGTCTAGACTTGGGTCGAAGTGTGGGTGAGTGTAGGCGTCGCGTGTGCATATCGTCTTCCCGGTTGAAGCAATTATCCCAGAGAG
GCCTTTGGTTAGTGGCATTCGTACActctcgccgtcttcttgggtGATCCAAAGCTCTTTTTTCAGCGGATCCACCAGCAAGAACCCGAATCGGTCACAG
TGGAGCAGCTTTCTACCTTCTACCATGACGACTCTTACGAATCTAGCGAcggaggcagcagcgctggTATCGTCGTTAGCTGCAGGACTGGATTTGTTGT
ATGCACGTTCGCCGTTATTATTCACGAAGTCTGCGAGCTGAAGCCGTGCTTCTGTCAACCGCTGCGACATCAACACGGAACGCAGTAGATTGGACTTGTG
CAGCGAGATTCCTGCGGCGTCAGCGGCATAGTTCAGATAGAGGGCGTCGTCTGCTGTAAACTCGTCTCCGTCCACCTTGTTGGTGGCGCACACAACGGCC
AAGACTCGACCGCCCGCATCTTTGACTGGCGCACAAAGCACTTGCTTCGTTTTGAGCGACGTCCATAAATTGTCAAACTTCGGGTCGAATGCTGCGTGAT
TTGGAGCTGAGTTGGTGAGTACGAGCTGTCCAGTCCGCATGACTACGCCTACAATCCCGTTGTGCGCTTTCAAGAACATCTCGTCATACCCACCATACCG
CAGATTCGCCTGAGACTGACGAAGCCTCTCGCTTGCTTTGCCCTTCGGTTTGACTTTGCTCCTCGATACTGCTGTGGTTCTCTCGTCCCTGCATTCGGTG
ATGAAGAGATAGAATTCGTCTGTTCCTTCGTCGCGCACATATAGCGCAATGTGCTCCGCGTGAAGCAGTTCATAAGATACTGCGATGATTTGGTGGAGGA
CTGCCGATGCACTGACTTCAGCAGCGATGTTTCGATTGAGTTTGAGAAGACACTCGATGCGGCCCTGCATGGCTTGATGTGCTTTGGCGAGCGAGAGATT
CCACAACGCCGTGCCTGTGGTGACACAGATATAGTCGAAGCTCTCTTTGTCGCGAGGATCGAACGCCCCCGTTTGTTGAGCTCCCTGGTTACGATCAAGA
TTTGTCAAACCAGATCGAGGAGTGGACGAGTACCAGAGCTCTGAAGGCGGAGCTGGGGTTGACTGGAGGCCGCGTTCTGGAAGTTGTTTGCGTGTAATGA
cctggaagacgccgacTAATATCCCATGGACGTTGAAAATGGGTGCGCAGAGCAACGCTTCAGGCTCGAAATCAAGGAGCTCCATCTGCTCTTCAAACAC
GTCGACAACCTCAGATCCACCAACGTCTGCGACTTCGAGAGGAGTTCCAGTCtaacacacacacacacacaggTTAGAGGACGGACGAGGCACGCAGAAC
CCAACGCGGAATGTTTACCAACACTACGCGACCAAATGTGGAGGCTGAATCGACGAGAACGCTGCCTTCTTCGGTAAGATATCGCTTGCCGTTCAAATCC
ATCGGAGGATTCGAGTACAACTCGACGCGGTCTTTCTTCTCGCTGAGGATGCCCACGGTGAACTTCTCAGCTGACAACACGTGCTGTGCAGCGCGCAGTG
CGTTGCTGACGACATCCAAACTGTCTGAAGCTTGAGAGATTTCGCTCATGGCGTCCATGAGAGAGCGAAGCTGCACCAGTGCATCACAGTTGCCGTGAGC
GATAACACACAAAAAATATCGACAATGAATGGTACGCGCAGAAGGCGTACATTctcttctcgttctgctAACTGGTTCAGCGTTTCGGCTTGCTCGCCAA
TGAGGTTGCGCATGCTCGAACCAAATAACTCGCTTTTGGGCCGAAGACGCTTAGGCAGCACAGCTTTCGACAAACCGTCAGGTCGATGGGGGCGATGCTC
CGTACGGTAACCCCCATTGCAGCAGTCCAGTTGGTTCTGTCGCTTGATCAGCTTGAACTCGAGCTCTTTGGCTTCTTCCTCCAACTGCGCCAGTTCCGCA
GCGAGTCGACGGTTGTCGTCCAAAGACTCTCTAGCCGCGTTCATGaccgtcttcagctcctgcactgGCACCCGCACCAACTTCAcctcgtcaccgtcgt
cgtccatggctcTGCAGAAAAGAACGAAAAAACTGCTCGACAACTCCCCACGTTGAAGTTTCTGCCTCGtcacatggctacattagGCTTGTACTAACAT
ACTTGAGGCACAAGTCAAATTTCAGGACAGAGACTGTACTTGGAGTTTGACTTGTTCCTAAGTATGTTTCAAATTCAAAGCGGTCCGATAAGCCATCTAA
TTAACCATAACCGTTAAGAACACTCGTTCAATTTTGCACCAGCCATTCGAAGAGCTCCACACTTTTAGTCATCACCATGGCGTCGCGTGCGTTCCGCCAG
GCCCACAGCCACCCGAATCCTCCGGTGCAAGacgaagcagctgcagccgcatTGGCCGCCGCCGAGGTCAAGCAGAACGAGCGCGAGAGGCTCGAAATCG
AGCGTCTAGAGGCCCGTATCGCCGAGCAGACTCCTGCTCGCGGCTCGCAGCTCGGTGACGCCGCCAGTTTCGACCTTTTCCCGCTGTCTGAAGCCTCGCG
ACGCGGCCTGAGAACTTGCGGCTTCACTGCTCCCACCAAGATCCAAGTGGGTGCGTTGCCGCACGCTCTAGCGGGTCGTGACGTGCTCGCAGCAGCCAAA
ACAGGTTCtggcaagacgctggcctTCCTGCTGCCAGTATTGGAGAAGCTCTTTCGCCTACGCTGGGGCGTGGAGGACGGACTCGGAGCGTTGGTCATTT
CGCCTACAAGAGAGCTTGCACTGCAGATCTTCGAGGTGCTGCGCAATGTGGGCAAGGCCCATGCGTTCTCGGCTGGACTGGTCATTGGCGGCAAGAATTT
TCGggaggagcagctccgtctcatCCGGATGAACCTGCTGGTGTGTACGCCTGGCAGACTATTGCAGCACATGGAACAGACGCCTACGTTCGACGCTAGC
AACTTGCAGGTGCTGGTACTGGACGAAGCCGACAGGATCTTGGATTTAGGATTCCAGAAACAATTGACTGCTATTCTGGAGCACTTGCCTCCGGCTGGAG
AACGACAGACGATGTTATTCTcagcgacgcagacgaaATCCGTGAAGGATCTGGCAGCGCTGAGTTTGAGGGAACCAGAGTACGTTGCGGTGCACGAGCA
GTCAGCGAATGCTACGCCAAAGGGACTTTCGCAGAGCTATGTTGTGACGCCGCTGGAACGGAAACTGgatgtgctgctgtcgtttATCAAGTCGCACctc
aagcagaagacgaTTGTGTTCTTGTCCACGTGCAGACAAGTTCGTTACGTgcacagcgtcttctgcaaaTTGCAGCCTGGTATCCCGTTGTGTGCGCTGC
ACGGCAAGTACAAGCAGGGAAAGCGTGTGGAAGTGTACTATGAGTTCTTGAACAAACCCGCGGCGGTTCTGTTTGCTACGGATATTGCGGCACGTGGTCT
GGATTTCCCTCAGGTGGATTGGGTGCTGCAGCTAGACTGTcctgaagacgctgctaACTACATTCATCGTGTGGGACGTACGGCGCGTTACAACAAGCAG
GGTAAGGCTCTTATGTGCCTTGTGCCGTCAGAGGTGGACGGCATGACGAAGCGACTTGAGGATGCCAAGGTACCTATCCGTGAGACGAAGCTCAATCCGG
CCAAAACCACGAGTTGCCGCCAGAAGATAGCGTCTGTTGTGGCCGGTGACAAGGAAATTAAATCGCTGGCGCAAAAGGCTTTCATGTCTTACGTGCGTTC
TGTCTACTTGCAGCCAGATCGCGAGGTGTTTGATGCCACAGCTCTGCCGCTGGATGAGTTCGCTGAGTCGATGGGTCTCCCTGGTGCACCACGAATGCCG
TTCCTgtccaagatgaaggaagaGCATGAGAAGGGTGGCAACGAGGCGTTGCGTGAGGAGCTTCGCGGAAAGAAGAACGTCAACCgtaagctgcagcagc
tcaaggaaaAGATTaaggcggagaaggagcgcaagcgTTTGGCTCGGCAACTGGCTGCTTTGAGTCCCAAGGAACAGGaagcggcgaagaagaagctgga
gcaaaAACAGAAacacgagaaggaggagtccgaagaagaagaggaagaggaggaggactcGCTCATGGTTGTCAAACGGGTACACAATTgggaggaagac
gaggagccACTGGATTTGGAAGCATTAGGCcccagcaagaagaagctgaagaagctgcgtgtGGACCGTGAGGCCATCAACGCGTCCAAGATCGTGTTTG
ATGAAGAGGGCAACAGTGCCAAGGTGGCGGACCGCCTTGCAGCTCGCAACATCGACAACACcggcgacgaagagttcGCCGACGTGGAGCAACACGCCAA
GAGCTACACGGAACAGGTGGCCGCTCGTCTCGCcgccaaggacgacgaggatcgtcgtctggagaaggaacgcGTGCGTGCAAAGCACCACAAGAAGCGC
ATGAAAATCAAGGGCGAACGCGACGGCgagagcgatggcgaaggcGCACGTCTTGTGGTTGGctctgacgacgatgaagacatgagtggcagcggcagcg
aaaacgagagcggcagcgacgacgaggaggacagCAgtagcgacgaagacgacgacaagaagaagaagacggtcGATCGTCAAGCCGTCGCCAACCAGGA
AGAGATGGCGTTGCGcatgctgcagcgtcggcagaCTCCCCCTCTAAGATACTCCTTCTCATAGATGCACATGATATCGTTTCAACGTGTCCACATCGAT
AAAAGAGCCCGTCCACACTTTAACGGTGGAAAGCCATCCCTCATCCTTCTTCCACCACTGTCGACTATGACCAACgccacttcctcttctcctgcCAAGC
ACCCGCTGTGTCGTCTCGCCAGCGGCATGCGAGTGCCCACGTCCGATGGCCCCtcaccttcctcctccacgcgtccaagtcgtcgtcgcgtgcGAGCTTT
GGCGATGATcctggacgacgtgctgtACGACCACTCGGGACTGTTGTCACACTTGGCGACGGACCGCGGAGTCGCTCAATTACTCGTGGAGGGCGCGTTC
CccaccaacgcagcagcttttgaGGCCTTGCAGACCTTCCGCAACGCTTACGGACTCCGTAAACGCTTCCCTCGGTTCGTCGACAGCCTCGTGGGCGGTC
CTCAAGCCAAACTCTCGCCCGTCCAGGCGCAACGCGTCATCGCGGCATACTACGAGAGTAATGTGCCTGAAGCGCGACGCATCACGCCGTTCCCGGGCGT
ACGGGAGAcgctactggagctgcaggacggaGGTGCCTGCCgtttggcgctgctgctgattggcAAGCCAGAAGTGCAGCGTGAACGACTCAAAGCATTG
GGAGTCGACGATTTGTTTGCTCAGGCGGTGTACGTGAGTCCCAATCCGAGTTTGGCGGAGGTGACGAGTGCTATGAAGCAGCTCACGAGACAATTGGAAG
TCCCGTCGTCAGCTGTCATGTTTGTGGGACGCAAGGCCTTCTACGAGATCAAGGCGGCGAATACTGTTGGAATGCTCACAGTTCGCATGGTAACGTGGCT
AAAGagggttgttgttgtggtcTTTGACTGATTGTGTGGCGTGTGTTGTTTGTAGTTGTTTGGCAAGTACACGACTGTGATGCCTACGGACGAAATGGAG
CAACCAGACTTCCAAGTAATGTTTTGAAGCAGGTTTCTATGAAACTTCACCACTGACAATGTGTGTGCTGTGTGGTGATGCTAGATTGAGtcgcttgagc
agcttgtgccCATTGTAAAGCTGGCAGAtcagaagatgctgcagcctAAGATCGTGGCTATTGGAGGAGGTACAGGTCTGGCAGTGCTGCTCAAGGAACT
TCGTCACTACCCCGCCGATCTTACAGCCGTCGTCACAGGTATGACTTTTGATTCATCTAAACGACTACAACTAACCAATTGTGTTTGTTTCACAATTTGA
TGTAGTGTTCGACTCGGGTCGTCACTCTGGCGCTCTTCGCAAATATCTTGGCATCCTGCCTCCCGGAGATATTCGCAACTGCCTCGTAGCGCTATCCGAT
TCAGGTTCGTAATTTCTTGCTTTGCAGTGCTATCGGTACAAGTTCATGGCTGATTCTTTAATACGTGTGCGCTAGATGAGCTCTTGAGCAAGCTGATGAA
CTACCGATTTCGCGAAAACTTCATGGAAGGTTGCAGTCTGggaaatctgctgctggcagcgctGACCGATCTACAGGGTGGTTTCGACCGCGcaatctcg
tcgatctcTGACATTCTCAACATCCGTGGTTCCGTTTTACCAGCCACGCTGGAAAGCACCGAACTATGTGCCGAGCTTACCGACGGCTCTACCGTTGTCT
CGGAAGTCAACGTGCGTAGCCCCTTTATGCCGGACGAAGTCGACGAACCTAGGTCAGGTTCAGACTCGGCTACAAACAGCACGAGTGGcacaccaccgcc
aacgccaccgaAGCCAGAAAACCAAAACGAGAGGGCCAAGAAAGCGCCGATCAAACGTGTATACTTGGAGAACTCGAATGTGGAAGCCTTCCAGCCAGCG
GTGCGAGCCATCGAGGACGCCGACATCATTATCCTGAGCCCCGGGGGTTTCTACACGTCGATTATTGCTACACTGTTGGTGCCCGGTATTCGAGATGCTA
TCGCCCGCAGTGCAGGTGCTACCGTCTACGTGAGCAACGTGACTACACAGAGCGGCCAAACCGACGGCTACACGCTGGAGAAAACGCTCGAGGTGCTTTC
GACTTATCTGGGTGCGAATGCCATTGACTACGTGatcgccaacaacacgtacCCACCAGAAGATGTGCTTGCACCGTACGTGGAGCGCGGCGAGGAACTG
TTGCTACCTACTCCCGAAATGGCAGCTACTGAACATCCAGTTCTGCTTCAAGGCCAAACCTTCCAAGAAAATCTCGTAGCTGGTCAAGTGGCGCGTGAGT
GGAAGAAGGCACCCATGCTCAAGCACAGCGGCCCCCGAGTGGCTGCCATACTCTACACCATCATCGACAAGGAGATGGCACACTACCGTCAGCACCCGCA
CATTTCTCCCAATACAATTCCGGTGGTTGCGGCGGAATCAAAAAAGTCGTGGTCACCGCGTTtcacagcaccagcaataGTGTTTGGGTTGCTGGCGGCT
ACATCATTGCTGTCATCCATACTACGTCGTTAGTTCACAAAGATCGACTTAGTGTGGCAAAAACAAAACCCAGAGCACACTCGAGACGCATAAAATATCA
CGCTGGTCTGAGCTCAGGAACGCGAGCATCACAAACATAAATTCCTGTCTTCCTCCAGAAAGCACAGCACACTAACAGTCCATTTTTCACACACAAAAGC
CCAACCTTCACAGCCCCAAACTGTACAGGATGTTGGGCTCATTTTCGAGACAGCGATGATAtagaggacgacgacgaggtaGAAgccgtggaagaagatg
atcTGGGAAGCCCCGCGGTGCCGTTGGATTGGCCTGGCTGCTCCTCGAAGCCGTGATGTGAGACCATAAATTCCGAGAACGCCTGCGTCGCGATGAACAG
AGTTCGGAACTCGCGCATTTCAGGTGTGGAGGCCGCAAGATAGCTAGCCTCGTCGAAGAACACGGTGCGTTTTCGAGCAAATTCGTCTGTCCAAACGTAG
CGATGATACCCAAAGTCGCCAATGAGTTTGTTTACAGCACGAAGAAAAAGACCCCGCACAGCGACCTCAGGAAATACCAGTGGTTTGCTCGGGAAGTGGT
GTGCAAACACGTGGTCGCTACGGCTCACGTTCGGCTTGAGGCACTCATAAAGTGCGTCGCGTAGATCATATCGTACACTGTCAGGAAGTGCACAGGGAAC
TTCGCCCCGCAAAACAGCTCCTTTGTCTAAATCCACAACCAACAGCTCCTCTCCAGCTCCCGCGAAAAGGTCATCGCCACCTTCCTCAATAACTTGGCGT
TGAGCATCGTCCAGCGCTTGCTTCTCGGCGCCAAAAATGAATGGTGTCGGGCACTCGAGGTACTGCAGCATTCGGCGGGGAAGCACTGGTAAATATACGT
GCGGCCACGACAATGGGTGCATGAGTGCTCGCAGCGATTCGCTGACTTTCATGAGCACCGAGAGATATGACGACACCAGCAGAATTCGATtttccagcaa
cgccgcgGTGAACACAAGAAGCACGGTGGAAACGTCAAGAGTATCGAACAGAAGACGCACGGAGTGATCTAGACGCGGAAGCGCTGCAAGCAATGAGGTA
GCGGTGGATTTTGGCGTTAAGCCAGAGGCTTCAAGAAGCGGTGATTCCGGCAGGGGCGATGGCTGGTGATACTGAGAGATGTGTTCCTTTGAGACAGCAC
GGGTTAACTTCGCGAGAACTTTCTTGTCTAACTGAAAGCCATGACCACCGTCATGGAGGACTCCTTTGCCGTCGCCATTGgaggcagctgcagcagcgat
agTCTCAAGCTCGAGAATGAATTCATAGGCTTCAGCAAGACGTTCTCGAAGAAGATCTACCATTGGAAACTTGGATAGCACGCACACTCCATACGGAACC
CATCGACAACCCTTCGTAGAATCTATCCGCGATGTTTCGAGAGCACGCCGCGATAGTGGAGGTGCTGGTTTATACAATACAACACAAGCTGCAAACAAtt
cagcagctgaagcaccagcactgcTGTCACCCATGCGGAAGTTAAATGCCAGAGGTGCCGGACAAGACGCTGATGTAAGCACCACGTGCCTAGAATCCGC
ACACCAAGGAACAAGGAAGTTCTCGACAGATTTGTCCACGACGTGTGGTGTTAGGTCATGCGGTAACGGATGCTGTACTACCTGCAGTTCAATCGGGTCT
TCAAACACGCCACTTCCATTCTCATCAGTGCCATCCTCCGCTTCTTCAACTGTCATTGGCACCGACACCGCTTCAAAAGTGAGCACGCCCGAGATGGCTT
CAAAACTCCGCGCAGTACGGAGCGAGTCAAGAGTCTTCTTTTTTGGCGTTGCTGTTTCTGTTTCTCGTccgctggacgaggaagaagtaGAGCCATTAGA
TGACGAGGAACTCGAACCACCGCCAACCCAATGATGCGCCCGCAACCCGTAGCTCAGAAGCAACGCCGATAATCGCATCGAGTCGTCAATAGAGTCTTTC
TCGTCCTCAGGTGATAGCTTCGGGTACAACGCAAATTCGGCGTAAGCACGGCTCGTTAGGAAGCGATGATACAGTTCCAGATGAATGAGGCTAAACTTCG
TCAAAATCGCATCTTGCTCAGCTTGAAGTCGGGCACAAGACGTCACCAGCGTGCGCGACAGAGTCTGCATCTCAGCATCCCCAGCATAATATTTTTGCGA
GATGTACTTGAGCAACCTTCTGCAGCGGTACGCAGATTGTTCTATGCGCTCACGACGctggttgctgctcgtgctgctggacgcagcagcgcttcgGGAG
CTTCCAGTAGACTTGAGCAACGACATATAAATACGAAACGCCGGTTTGAACTCATATTCGACATCCAACCACAGCGCAATCTCACGGTGGTAGTTGTGTG
GGAAAAGAAAGatccagaagaagttggcgaacCGGTGGTTCATCAAGATATCCTCAAGGCAAATGACTTCACGCTCCACAGTCTTCTGCATTTCAGTGTA
GAGTTCCGTCTTCCGAAATTCAGGAAACTTAAACATGAGTACTCGCTTCACCTTTACGGCGACGTCATCAAAAGTTCGTAGTGCATCTTCACCACCGGCG
GCCAAATCGCGCTTGATCGAGCGCAGTTTATTGGAATCCACAATTGGGGGCTCGTCACTGCCATCTTCTGTATCGGCAGTGCCATTAATCGGGAACTGCG
CGTTTTTCGCCAGATATTTCATGGCAATTTTGACACCGTACGTGCGTAACATAAGCACGTCATCCTTCGCAAAAGGTTTCTTCTGGTAGTTAGCGCGCAA
AGTGCACCAAAACTGCCGGTATTCCTCAAATGAGCAGAGGAAAAATAATTTACTCTGGTCAGCAGGGTCAGGGAGCCACGCAGCGTAATAGCGCATCATC
CTCGGGTTGCTAATAACTTCCTCAATAGAAATAAGTGTCGTCGGATCTGGGGTTGGCTGATGGGCTGGGAACGCaaattgttgttgttccCGCTGCAAAA
CCTCGTCCTTGAAGCCGCGCTGCATCACTTTTTTGGCGAAATTGTGTTGATATTGATCATGCATCCATCGATTCCATTTCTGAAACTTGGCACCTCCATT
CGACGCAGGTGCAAAGGACGGCAGTGGCAACAACGAGTGATGgcttgtcgtcgacgacgacgccgctgGCGAGGCTCCCGACATTGCACCAAAAACGCTT
CCGCTGCTCATTTGCGCTAGAATCTGCTTCTGTTTGTTCGCCCAAATCTCTGCCGACGTTGGTGTCGCCGACGTCATGACTCCACTATTCCCACTTTCAC
CAGCAGCCGAAGCTCCATTTTTGCTGCCGGAAACTGTAGAGTAAAGAAAACTCCGAGCCTTGAGTTTCACATGCTGTGCCCACCTGGATTTGGCGTTTTC
GAGCTTgacatcttcctcctcctcctttaTACTGGTGACCTCATAGCTATTCACATCTTCGTCCGATCCACTGAGCACCTCCGACAATTCCCGTACACTC
AGTTCCCTCTCTGGTTCAAACAAGTCCGTCTCATACAACATCTGCTCCGAAATAGTACTCCTCCTGAACGTACTACgactcgagaacgagaaggcCAAAC
TGTCCCTCGATTGTCTCGACATGGCAAGCGAGTCTCGCTCATTTGCAATACTCAAATTGCCTCCCACTGCAGTCGACCGTCGCTGATGTGGCAATAAAAA
GTCGTCCTTGTCCGTATACAGCGACGAGCTCAGCGCACTCGCCATACTTTCTCGAAttacttcttcagctgatATCGTGCTATCCGGCGGCAAGGGCGGA
CTGGAATCCAACGACGAGGCTCGTCTGTATCTCTCCGATCCACTGCTTCTTGTGCCGCTAACTGTAGACTCCCCCAACATGTTCCTAGTGAGTCGCCCAC
CGTCCGAcacggcgtcgtcctcgtcataACTCATTGATCTGTTGCTATTACTCTCCACCGACTGTCTGGCTGCATCAATATCCATCATTAGAAAGCTCGC
GTGGCTGCGTAaagccgaagaagacacggGGACGCCCGCGCCTGCTCGGAAGCTTGACCCTGCGCTGTTGAGTCGGAATGAGGAGCTCAGGCCGCCGCTG
TGGTTGAACGGATTGAAACCCGAGCGACTGAGACGGCGCCCAGCGCCCACCACGTGGTCGGCCGATGCACTGCGTCGTAGCTCCATGACGTCACTGGGTA
ATAAGGTGCGTTCGCCATTGCCAGTGTTGGAATCGTCGGCATTGGACACGGGACTGTTGACTGGGGCGGGGGGCACGGGCGTGTTGAGGACAGCGCcact
gctgcgactgcgacgacgaggacgcgTGCGGATCTTGGCGCactcgaagtcgtcgctcatgacgccACACAAACGCAGGACCAGGACGAGGGGTGGAGCA
CTGCACTGCGATTGAGCTTGAGTTCGATGTGTCCTTCCTGCGGATGCGTGTGTTCTGTGGCCCGTGCAGCGCTCGCACTTTTACTGTTTGCAGCCAGAGC
CAAATTAACGTGTCGAATTAGCTgatggctgctgccactAAATCGGACAACAGGATAGAAATATATATGTGAAGTGGCGTACACCATTTTTATCTCTTTC
TGATTCATCTTTCTTCAGATCTCTATTCCATCGGGGTTGATTGAGCTTGTTGCAACAATGAGCGAGCGTCGAGTGAATGCCGCGCAGGACGCGGTGATTA
AGGTGTTAGTGCTGGGCGATGCGGCCACGGGAAAGACGAGTATCATCAAGCGATACGTGCACGATGCCTTCTCGGAGCACCACCGCACGACGATCGGCGT
GGACTTTGCACTCAAGGCGGTGACGGTGAATGGCACGAcggtgcgtctgcagctctggGACATCGCAGGGCAAGAGCACTTCAGGGCGCTCAACCGCGTT
TACTACAAGGACGCACTGGGGGCGCTGCTGGTCTACGACATGTCCCGTCCAGAGACGTTTGACAGCATCCTTaagtggaagaaggagattGACTCCAAGG
TGGAGCTCCCCAATGGGAAACCGCTGCCTGTCATTCTGTGTGGCAACAAGGTACTGTAGAGCTTTACAGCAGTGCTTGTGGAGCAGGATTGGATATTCGC
TGATGGGGGACTGTGTTTGTGTTGTTCTTGTCGTAGTGCGACTTGCAGGAAAATGTGGATCGGGAATTCCTGGACGAATTCTGCAAGACCAACAACTTTG
CAGGCTGGTTCGACACATCTGCCAAGGAAAACATCCACATTGACGACGCTGCGAAGGCGCTGGTGACGGGAATTTTGGAGCACCAAGACATTTTCGAGCG
AAAGTCAGACGCCAAGAAACGCAACGACACCTTCCGCCCCACGAGTGCTCCCAACGGAGGCAACGCAAACCAGtcgagctggtgctgcagcagcttctaa
TCTACTCTCCCGCCGGCTGAAATGAACGATGTTTGCATTTTCGTGCTTTGGATGGACGACGTTAATTGACTTTGAAAAATTCCAACAACCACGTATCACG
TACTACTGCGTTGTACCTCTTTCTTTATTATACTAAGGCTGGTCATGCAGACGCCGCTTTTTAAAATTGCCACCAGATCCGTCGCTGCGCCTAACCTTGC
TGAAATGAACTGGTAGGCGGTGGTTAACCGACGTGGAAACCCCACGATGCTCCATATTTCTGCGCACTTCTCGGAGGTTAAGTCGTGCAgtgctgagctt
ctccagcaattcCTGCTTGTTGGCCTCTGCTTGGTCTAATTCATCCTCCAGTTGTATCACCTCCTGCTCGCGCTCATCTGGCCTGTGATTCGTGAAAGAA
GCCGTTATGTCGTTGATGATCTTTTGCACCTTCGCCTCCGCCTCCGGTAGTTCCGCTTCCGTGTAATCGACTGACCGAACAACCTGGCGCTCTTCCACTC
GTAGGCAATACTCACAGGACTCACTCTCGCCTGTTGCTTTACACTGCGAAAGATGTCCGAAATGGTGTTCCACTGCCGTGCACATTACCTGAGTGCAAAC
CTGTAAATCCAGGTGATGTTGCAGGTGATCGAGGATTGACTTGCAATTGAGGAGACACTTCTGTGTTTTGGATGGAGCACAAAACGATGCATCCACAATG
GCATAACCCAGCTCCATGACTCCATCAAATTCCCGGTGCGCAACTTCACTGCCTTCTCCACTTTCTGACTTGGCTTGTAATAGCTGGTTGATGAAATCCA
CGTTGAAATTCGCGCTGCCTGGTATGCTGCCATCCTGCGTGTCCTGTGTTGGCTTGGTATCCGCATTGTCATCTACGGAAACACACATACACACACAAGT
TAATGCGTGGCAAGAATTCAATATCATCCCCAAGCATTCTCTTACCTGGAGTAGAGCGATTTTCTCTTTCTTCATGCCCAGCAGAAGGTTGCTCAGTAGC
TTGCACCCTATTGTTATCATCCGTCGATGCTTCAATTGCAGGTTGCTCAGCGGTAGCTTCCTCGGTCGGTTCTCGTTTGATAAACACGTTATCACTAAAG
TGCCACTGGTACCTCGGAAAATTAAAGATGGGTAAACTGCTTTCGCTTGCTTGTTGATTGAGTCTGTCAGTTTCGGCTCGAAGAATCCGCTTGCGTTGGG
TCCACGTTTCAATACTCTGCAGACAAAAATTGCGCTGTGCCTCGCTGTGTGCGCCATGAAGTGCGCGACGCTGGTCATTGATTAGATAGTCTAGCGCTGC
ACTGACGCCAAGACTCCGCCTTTGTCGAATTCGTATGCAAAACGGACACACAAACGTTTTGGCGTCAACAGTAGCTGGGGTATCCTTCTTTAAGCATGCG
CGTCGATGCTTGTACACAACTGATATCTCCATACACTTCGGGTTATGGCACAGTTCGTCTCGCTTACAGTGCTCGTAATGCAGCAAGACAGAACGACACA
CCGGGTCCTCACATTTTCCAATTCTTGCACATATTAGTGCATCTTCGATAACAAGGGCTGATTGGATGCGCGCCGCCAGCATATCCATTAGCACGCGGTC
AGTTGCTGGGAACCAGCGCAGTAGCTTATCAAGGTCTACTGGCTTCGActgcggcgtcgacgctTGTTTCCTCCCGGGAGTAGGTGTATTATCTGCATTG
GGTTGTGCTACCGAAGTAGCATTAGCAGAGTCACGCACAGCCGGGTTTGACGCGGGAGtaactgcagcagcagaggcagGAGCGGCGGGCGAGCTAGAAG
AGGACGGGACTTCAGCATTAACTGGTGCGGTGGCAGGAGAAGGCGCGGGGGccaaagttgaagtgttGCTAACTGCAGGAACTGCAACTGTAGCTGGAAT
CGAGCTGTTGGCAGTCGGCTTTGAAGTAGCGTCAGGAGTCTCAGGAATTAACGGTACTACCGGAGTTGAAGCAGTATTTGCTGGAATAGGATCCTCCTGC
TTGCTCGCTTGACTTGCAATCGACTCGTCTTGCTGTCCCTTTGTACTCTCCGTCGCTGAATTCGAAACTTCTGCAGAttttgcagctcgtggtgcttcCA
CAGAAGTGACCTctttcgtcttctcctccggTTCGTCATTGTTCTCAACACTTGCAGTATCTCCATCCTCTTTACTGTCAACCGACTCGCCCACCGTCTC
AAAGGCAAACTCTTCCTCCATAGATTCGTCCTCCTTcccttcctcctcttgtTTCTTTCCATTCAAGTTACCTGCATCTCCTTGTGCTGTAACTTCAGGC
TTTGCTTCTTCCGTCGgcttttcctcctccttttgcACTGTAGCTGCTGGCATCGCGACATCTTCTGCGCCATTCATTGCTTCAACTCCATTTGCGACGT
CGCTGACTCCATTTACTGCAAGATTCGCATCCGTCTCGACAGCGCTGTTATTGCCACTggtgccgttgctgctgcctacACCATCTTGCACCTCCAGTGC
CCCCCAAGCGTGATACGAGCGAGTTTCTCCGTAGCTGCTCGTGAGCTGGTGGTTGCGCGCATAGCCGCGCGAGTGCCACAGCGTGGAGCAGTCAGTGCAA
aacgtcttctccttgcgcgGGTCGCATGTGGAGCACTTGTACCGCCAGCGCGCCGCCCGAcaccagctgcagaaggtAGCCGAGTCCACCATCATAAAGG
CCTATTGTGAAATTTGAGGCGCGAAGTTTGACTCTGTGAGACAAATATAGCAGATACGTAAGCAAAAAAACGACGAGGGCCTGATCTGATTGATGATGGA
AGCGACCACCGCTGCATGGAGAGCTCTTCATGGCAATGACAGCACTACTGACTCAGCACAACTCTGCAGTAGATAGAGGCATACTATTCATGAAGAGAAT
CTTTTCTTATTTATTCATTCACGAGAATTAAAGGATATCCTAGCAGGTGATCAAGATGCGTCATGGACGCCACGCGTCGCGCCGTAGAAGAAGCAAGCAG
ACACAAGATGCAAGggcaggagcagcagcagcagcagcaacgtcggtccaagcaccaacacagcacctgcagcagaacaaTCAAAATCAAGCCGCACACA
ACACCCTGACTCAGCACGAAAAACAAACCAAACTGAGATTTCGCTAGCTTGCACTTTCCTGCTGCTTACCGACTGACTTGTCCTCgctctccatctcgtc
ctcaccagcagcacctgaaCCAGCAACTCCGAGACCAGCTAAAGATAACTGCCGACGTAGGTGGGACGGGACGAAGAGAGCTCCTACTTCCTAGCGTGCT
CTAAGTGGCGTACTTGGCGGTCCATTCGCGGGCAGTGGCGTCGTGGCGCGCGCGGTCTGTTCTATAAATTTGCGCGATCTCGGGCACCAGCGGGTCGTCC
GGGTTGGCGTCCGTGAGCAGCGAGCagatcgacagcagcaccttcgagATGGTCAGCGCGGGACTCCACTGGTCCTTCAGGATGTCCAGGCAGATGCCTC
CGTTGGCgttgatgttgcagtggtAGATGCGCGTCGTGAAGTTCACCTTGGGCGGCTTGAACGGGTAGTCCGCCGGGAAGTAGATGTTCAGGAAGTACAC
GCCGCCAGCGTACGGGCTGTCCTCGGGGCCCATGATGGTCGCCTGCCAGTGGAACAGGTCGTCGCCCACGGGGccggcgctgcagttggcggGCGGGTCG
CGGCCcaggtcctgcagctccttgttgATCCGCTTTAAAGCcatctctctctctctttgtCTGCTACTTCCCCtctctcgctcttcttgtgctgcttcct
gctACGAAAGGAAAGTGACAGCAAACAAGGGGGAGGTCGGGGGAGAAAGCTCCCGTGGCTCCCCCAAAAGAGCAACTGCGCGGCGGTTGACTAGACGGTT
GTAACGACGGTTGCGTAATTAGGTCCTTCTGGAAGTTTTTCTTCGTTTTCGGCGAGAACCGACCTGGGTGGGTCGAAGCTCTCGTACTTAGTCGGAATCC
ACCGCGCGATTGGACAAAAAGAAGTCGGCCGCAGATATCCTTGCATGCAAGGAAGGCTCACTTTGCTTTCTCTCAGCAGCGCAGTctcagctgctgcctt
tGGCAGTGCGTATTATGGCGACTCAAGGCGGAGGCTGTTGTGAGGTGCAATTGCTACGTGTAGTAGATAGATAGAAGATCGGAGGCATCAGACGACGCAc
tgtccacttcaactgcacTAAATTGCTCGACTGACCGATATCGCCaacgcagcacttgcaatAATAGCGAGCGGTGCCGCCGTCtcctgtcgctgcttgt
tgGCGACAATTGCTTGTTGCTTTTGCGCGGTACCGGTACCATTGGTGAGACAACGGCACGATAGTGGGGACAGcctcgacagcgtcgtcgtaGACGCTAT
CAGAGACAGGAGCGTCGCCTGCTTGCTCGTCAGCCGCGCGAAGCAGCATAACCGTGTACATCTACTGCAGGTTGCACTCAGAAGGGCACCAGCTCGGCCC
TCGCTGCAGATGTTGGTCCACTTGACCTCGCCACCTGTCGAGCGAGTCAGacgcttcaacatgatccCTTCGTCGTTAACCACATGCTGCGATGACCGCC
TTCACCCCCATGCCGCTACATGTATTATAAAATCCGAGTCTGCTGGGAAAACCCTTGCAATAATCAAACGATGAGGCTCCGACATCCCTATGTATACTTC
CGCGTCTGCTGCATGGGGCTTTCAGCACAAATCTCAGTCCCCGACGCAACCTACGCCGCCGCAAAACCACAACCCAATTTTTTTCATGCTTTGCTTTTCC
CCTGCAATAATGCAAAGGTGAACGCGACTTTACCCGTCGTCGCTCGTTACTCACACCTTCCTATTACGATATTCGTGAAAATCCCTTAAATTATACCATA
AACGATTCCACGGTTGGAAATGTCTTTCTATCTACTAACCTTCAGCATTCTATTCCCTGTCACACAATGAGTCCCGCAGTTTTCAGCACCGCTTCGTTGC
TTTGCTCGAAAAAACTGGCTGGATTGCCAACATCGGAGGTCGCCACTCTCAGTCTTGCCtctccgacgctgcagtccgCGGTCGGCCCAACTTGTCCAGC
CAGTTTcctctccttcatctccagccaTGGGCGACCGGTACCGCAGCGCGCAGTCTccgcgcagcagcggcggcatgAGCGACGATCGCTTCGGCAAGCT
CGTGACCGAGACGAGCAAGGGCATCTCGACTTTCAACCAGCTCACGCGCAGTATCGCGCAAAAGATGTCGCTGTTCGGGACGCCGCAGGACTCGCGCGCC
AACCACACGCAGATCAAAGAGCTGACGGAGAAGGGCAACAagctcgtggccaagatcaaCCGCCGGCTAAAGGAGCTCAATCAAGGCGCCAAAGGAGCGA
GCGGACGCACGAGACGCACGCAAGTCAACAAGCTCTCGGCCGACTTCAAGAACCAGGTGCGCGTGTTCGAGGAGACGTGTGAACGGCTGCTCGAGTCGGA
GCGGCAGTCGGTCGAGTTCATCCGCCGCTCGTCGCAGAGCTTCAAGGGCGGCGACGGCCGTCAGACACGCGGGGGAGCAGAGTTCACCAACTACAGCGAG
GACCAGATCTACGCACAGGCCAATGTCGTCATCTACGACGAAGATGGTGCGTTGTTAGGTTGCTGTATGGATGTTAGGGATGATTGACTGACGTGTTGTC
ATTGTGGTATTTGTTTGAGTAGATATGCAGCGGAGGGAGGATGACATTATCCAGATCAATCACCAGCTTCGTGAGGTGAACGCTGCGTTCCAGGAGATTG
ACGGACTGGTGCAGGACCAGGGAGAGACAGTGGTGGAGATTGTGGACAACACAGAGACGGCCAAGGACAATGTGGAGAgggcgctggagcaggtcaAACA
GGCGGATGAGCGCAGGAATTGCTGCGCCTGTTCAAAGATGAAGCTCATCTGCATCGCCATTTTTGctttgctcgtcttcatcgcacTCATGGGCATTATC
TTCGCCGCCAAGTGATCAACTTTTTTTTAGGGTTTAGTGAGGGCTCGTCACTGTCATCAACGGCTTGTGAATACAGGGTGAAGATGCAAGAGGAGGCAAC
CATGCTCGGTAATACGTGGCAACGGAGCTCCGAAGCTGGTTTATTCTAAATAGTACGTGGGAATGTATAGCTTTGTGACCATGATACATGTTGTGTCTTG
CTGGAAGTTTTTTTCTGTCCAGGCAAGGGATTCTATCGTGCTATCCGAGCAGATAGCGACAACTATTGACAAGTTTCAACCAGGAACACTATTCCTGTGG
AACTCGGACACGAGCACCGATTTCAGTGATCATGTGCGAACCGCGGCGTGGCACAAGATTGGTCTTTGAGCGCGAACGGAAAAAATTGTCGGCCACAGAT
TTGAGCAAGTTGCCTACGGAGCCGCTGCTATTCCGTCGGTGGCGAGTGATTGTTTCCaaggttgctgctggatcatCAGTGGCGCGGTGACGCGAAATGA
AACGAGCTTCtgcggacgagctggtggcCTTCTTGATGCTGGAACCCCGACCGGTAAAACGAGACCTAGTGTCCACGGAGAACATCGCTGAAAAGGGGAC
TGCTGTGTCACGCTCAGATGAATCGAAGCACACAGCACATACTCGCTCCTTATCGTCTACATTCTCGACAATGCCGTTATAGTACCGTGGAGTACCATGC
ACACGAGCCATGACGGCTTCACTGACGGTGAAATTCACGGGCGTAAGCTCAAACCCCATGGCGTCGATGCTGTAATTCGTCAACTTCTGGGTATGGGATA
ACGCGGTGGCGTCGTCTAGGCGGGTGATCTTGTCAGGTGGCACAAGTGTCTTGGACTCGCCGTAGTCAAAAACCACCGTATAGTGTGGGGTTGATGTTGC
CATCGCGATAGAGTGCACTGTCGGGGACGCCATCCCATCAGAATTCGCTGATGGCTGTGCTATCGTTTCGGGAGCAGTGGTGGAGAGATCTTGAAACTCA
TTGACAGCGATTTTGGCAGAGCAGTAACGTCCAAAGCGCGAGCTCCAAGCGAGGACATAGTCTCCTACCGAATAGCGCATTGTTCGGAAGCTGTGTTCTT
TCATGACCGACGTGGCTGTGGTCTTTGTGAGCGTGCGCTGTTGATCCACGCTGTCGAGTATCATTTGAGACGGAAATACTTCGAACGCAATGGTGCCATC
CGAAAAGCGCAGATCACacgctgaagaagggtgcgtTTTAATTACAACGCAGctttcgacagcaacttTACGCGGATGGTCTGCCTTGACTTGGTAGCCT
TCTTCCAGTATGGGTAGAATATTTCGACTAGCACCTGCCGATGCCTGCATGAGCACGGCATTTTTTAAAGACCTCACATCTTGGTCTGCAGGCACACTAG
TACGTTTCCGCTTAAAGATGAGGTGTGGGGGCACTTCGTAGCCTGTGGACCCGTCGGCAAAGTCAACTGCAGCCGTTCGGTTCGAGTACACACCGTTTAA
AAGTCCCAGTTTTTCTTCTCCCGCCGTGATATCAAGGTCTCCGCTACCAGCGGAACTTTTGACGTAGATCTGGTCACCAATATACACCCGCACTTTATTG
CTGCAAACCAGGAACTGGTCTTCAGTTATGGTTACCGCAACTTTTTTCTTTTCATGCATCGGGCTGATACTGTCCGCAGGTACATTGACGAGTCGAATGC
GGTTTGATAGCAGGACATGAAAGCGCGATTGATAGTCCTTTTCCAGAGTAATAAGTCCACACCCAGAAAAACGACTCCCTGGATATAGCGAAACCTGAAC
TTTTTGACCAGCAAAGAGTACGCGTTGAGAGCGCTCCAAGTCCGTTAATTGTTGCTCCAACTCCCACATCGACGGCAGAATATCAACTTTGTCTTCGGGC
ACAACCTGCACAGATATACTTTGATCATCTTCAGTCACGACAGCGTAGCTCGAATTCTCAACCCGCTTTGTGATTGTGCCGTAGGCGCGGATACCGTCAG
GAGCGCGTTCGTACACAACACGACTTGTACTCATGTCAGACTCGGTTTGATGCGCAGAGGCTCCAGAGCCAAAATTGGTCGAGTTGCATCGAGTTGATCG
CATAGTGGTGAGTTTCGCCTCCATTAGTCGGATGTGCTCAGCTAGTTCGAGCTCTTCGCTAGGTTGTGCAGGCTGCACCTTTTTGTTTCCACGCATAAAG
TACTCGGTGATAATCTGCTTGAGGCTTTTAGGTGCCTTCTTCATGCTCATGTGCGTCAAGGAAAGTCGATCAACCTGAGAGACAGACGAGATGCTGGATC
TTCGCCCTGTGCCGCGCTGAGGACGTGCAGGTTTCCCCATGCCAAAACTCTGCGTCATTTGTTGCCATGGTGTCATTGACATATCCTCGTCGCTTGAGTC
GTCCGAGTCACTTACTTGCGTCGAGTCATCCTCGTAACCCACCCCGCATTCAAGTCGCTTCATTGTCAATGTTTCGTCGTCTAAAAGGAGTCGCCAAGAT
CTGCTATCTGGATGAATAATACCACACGGCGCACATCCGTTCGCACACCCCGCACCTGAGTCGTCAAAGCTGAGTATCATCTCTTttggtggcgtcgtgg
aAAAATCTACCATTACGTGATGTGAAGGTGGCAAATCTAGCTCAGGTGCTTCAGAAGGGTCCAAACAATGCTCACCGCTCGAGTATGATTGTCGCCGTAG
TTTTACGTCTGTAGATAGTTGACTTTTGCCATTTGATTTTTCCATCTCCAAACCAGTAAAGCTGGCACCGTTCGTATTCGCCACCTCTTCCTCTCTTGAC
AAACCACTGTTGCGCCGTTGTTTCATCTTTTGCTGAGCCGATGATGTTGTAAAAGGTTCTCGCAGCACGATATCCTCGCGTCGTACTCGATAATCGAGCG
TTCCGTCATCGAACACGATCATGAACATACCTGAGCCCAGATACGTGGCGATATGACCCGAGTAAAAGTATGGGGTTCTTTTGTATCGGCCGAAGACGGA
TTGCCCATAGGTCCACTGAGAGTGCAGCGGGACAAATCGAGTGCTGGAGGTTTGCAAAACCTCATACATCGTAGTATTTGCGACGTCGGAGGCGGACTCG
ATATTGTTTTGCTCGTCAGATTGATTTAGCATGGCTTCTTGGGTACCTTGAGCCTCATTATCCCAATTCTCGACTGCCCCTGGATTTGGTGCCAGTCCTT
CCTTCGCCAAACCGACTGATGACTTCCGCTTAGTGGAAACTGCTCCATTGCCAAGGacttgaagccgttggcTAGGTTGTCGAACAGGTAATATTGGTAA
GGCTGCCTTTAGAGGATGCTCATTCTTCGAGGGAAGGGCACCACTATCGTGAATTTTCAAACGTTCGCTGGGTTGACGGATGGGCGAAAGGGGGGGAACT
GGTTTGGCTGGAAGCTCTTGTTTTTTTACTGGCATTTCGACGATGGTCGCTTGGGGATGGCTGCTGAAGTCTCGGGCTGGAGTGGATTGTCGACTACTTC
TGCGCGATAAAGTTACTGAAGGTACCTCTTGTATGCTGGCAGACGTAGTACTGTCGTGGACTTGGAGTCTCCCGCTCCGCTTGGCTGCGGATGACGGTCG
GCTAGACGCACTTGGTGCAGCCAATTCGTGCTTGCTACCAAGTAACAGCTCGATATCCTGAGGCTGAAAACGCATGTTGAACTGTTGTGAGTTGATGCTA
TGTCTATGAATCATCGATAGGACCCCTTCCCTGCTGGTAGCTAACCCGGTGTCATAGACTTGGTACTGTCCACTAAGGTGAGATAGCGACTGCCTGCTGG
GTGATGAAAGTGCTGCTTTCGGTGGCGCATCCCGAAGGTCTTTCGGATCGGGTTGTACCATTTCATCGTGAATCAACCGGTGGCCAGTGGACTGCAAGGC
TGACGGGGGTCGATTCGTCGGGGATGCTGATGTTTTCGATGTCTCACTACCGCGGATTTCCTGCGATTCCTCGTGCAGGTGGAAGCGACCACTAAGGTGT
CGGGACGACAGAAGTCTTGTCGACCTGGAGTCGCTTGCGCCTGCCCCTCGCATCTCATTAAT