Description :
From Genome Similarity Track
Location :
Scaffold_94:102243- 114483
Transcript NameFunction/comments
Phyin_T30-4PITG_19472Ubiquitin-specific protease%2C putative
Phyin_T30-4PITG_19473Putative uncharacterized protein
Phyin_T30-4PITG_19474Cobalamin adenosyltransferase%2C putative

Sequence
12240 bases(100 bases per row)
GGCGTCTCATTCTCCAAGCTCTGTATCACTCTGACATTGGTGGCTGTCGCTGGTTCTTGTCGACTATGGAGGCAAACGAGGCGCTGCTTCTGGAGTTGCT
GGTGTTTAACGAGCATCGTGAAGTGCGCGAGTTGATGGCAAATGTCATTTCGGAAGCTATTGTCACGACGTCCAATACAGAGTTCGAAGAGGAGGCAAAA
GAAGAATCCGAAAGTTCTTCTGGCGACGGGAAGAAGCGCTTGCCTGCGTCATTCGAGTTCATGTTCTTCCTGATCCAGCTGATGCCTGCGTTGCTTTCGG
TGCCTGTCCAACACCATCGTCAGTATTTCCTCACGATGTACGACTTTGTGCAGACAGGACGCAACGAAGGCTCCTTCCTCGTAGTGAACAGTGTGGTTGG
CGCCATCGTGTCGCTTCTTACAGGCCTTGGAAACACGCAGCCACTGCTCCAATTGCAGTTAAAGAAACACAAGTCGAAGCAGATCCTCAAGCGTATCGAC
CTCAACGTCACGATATTGAAGCTCTTGTCGGTGCTGATCCGTTGCAGCTTGCCTCCTGCCATGGACGTCGAGTCGGATGCTGAGCACCCTCTGATTCTAC
CGGCTAACATGGCTCAAGAACACGTGGATCTCACACCAGCAGACCACGACGTGCTTCTCAACGAGCGTTTCATTACTCTGCTCACACAGCGCGCGAACCG
CTACACCAAGGAGACGAAACCGTTGGAGCAAATTGTGAGTCATCTGTGCTGGGAAAGTCGACGTGTCACTGCGGCCTTCCTGGACAAGATCATACATGGC
ATTGAAGTGGAGGACCATCACGACGTCAAACCATACTTCCGAACACTCAATTCGCTGCTTAAGGTCCGCGATTCCCTCGCTGGAGAGCGTCTTACCGACG
GGCTCACGAAACTGGTGGCGGTGATGGCGTCGCAGCAACGGTATTATAAGGCCACGGAGACGTCACTGGATATGCTGGCACGACTTGCCAAACGCCACAG
TGGCGTGACAAGATGGCTGCGAGACAACCACCAGAGTTGCGTGTGGATGGAGAAGTGGCTGATGGCTCATCGAGGTGCCGAGGGATATCTGCAACAACGC
AAGACTGTCCTGGTGAAGCCCAATAGCACGTCGTCGTGGGTGAATGTGAGCGCAACGAGTTCAGGGCTCATCAAGGCAATCGATCGCTCCATCACAAAGT
TGCTTCCACGTGTCCGCAGCATTTTAGACCCGGAAGCTGTCGTAGAAACATTTTACGACAGCGACGACAACCCGCAACGTCTTGTGGGCAAACGCGTGCG
TGTGAAATGGGCCAAGGACAAGTGGTACGAAGGCACGGTGCAGCAGTTTAACGAGGATACGTACGAGCACTTTGTGGCATACGATGACGGCGACAAACGG
TCTTATCACATGTCGGAGAAGCTTTTCTACGTGGTGAGCCTCACGCCGTCGCCTAAGTTTCGCAAGAAGAAAACCCAGCAGCAGCAGGCTTGACTTGCGA
GCTCACAGTTGTAGTTTATTCTATAAGTGTATGGCTTTCTTGAACAAGTTGGCCATCCTGTTGTGTACTGGCAGATTGAGTGTGAAGCTTGTTTTTGGGT
TCTGGTGTGCGTACGAGTCTGGCTGTGCGTTGATGGCGTCTCCATTTTTGTCGTCGAGCATTGCAACGGTCGACGTCTATTGCTGATCTCAGCAGAATTA
GTCCTGGACCATCGTTGACGTGGGCACTTTGAAGTCTGCCGAGCATTAAGATGACGATCAACCCACCAAAATGCGCAGTCAACATGGAGCAGCGACTGGC
AGCACTGCGACGCGACCAGGAGATCGACGGGTTGAGGGTCTATCTTATCAAGTACAACCTCTTCCCACGTAATCGAGATCCGCACAACTCGCCCATTCGA
TTGGAAGAACTAAAAGAACTCGTCAAGCACTGGAAGCTTCATCGACAACGAGGGTTTTGGCGCGATCATCCGGATAAAGACGACCTCGTTCGCGCCTTAC
TGCAGCATATCAAGAGCGAGGCAGCGAACAAGAAACGACGACAGGAAGCACAAGACAAGTATCGCAGTAAAACAATAAGTGGAGCTGATGATGGCAGTCC
TGGCAAGCATCGAGACTTCTCGACGTTCTTCGGTGGCAACGCAAACGCCCACTCGAGTGGAGACGAAGCCGAGAATGACGACGATGACCGAGAACAGTCT
GTGGCTGTTGCCAAGAAGAAAAAATGTGGTGGCGATCTGTTCTACCAACGCGGAGACTACGACGAAGGACTCATCTATCTGTCTCGAATCGACAGGTCTC
GTTTCCAGTCTGAAAGCCACAATCCCTGCCAGGATCTGCTCACGACGTCTGCTTCAGCACCCACTCCAGTCGACCGTCTACTCCTGACAACTCCTGACGC
CAGCAGCAAGCCTAAAAGTGTTAGCGCCACATCTGCGAATGACAAAGAAGGCGAGCGAGCAATGAACCAGATGCCGTCCGTGTTGGTGAGCCCTCTGCTC
TCTGGATCCGTAAACACTGCACATTTGACCAAGGATACGAAGCTCAAGTCTGTCGAAGGTCTCTACAGCATTTCGTACCACAAAGGCTACGAGGCTCAAC
TCCTGCGTGAGGGTGCACTCGCCACGTTGTCCAGCGTCCTCAAGCTAGACGATCCAATTATCCGTCTGTACTCTGCCGCGGCAATTTTGAACCTCACGCA
TTACACTCCAGCCCCACCTTCGCCCCTGCCTACTCCAGTGAAGAAGAATCAGAGCCAGCCATCGTCATCTTGTCTATTGCCGACGGCACCTCCACAAGCG
ACTAGAGATTTGTACTCGAAAATGACGGACGAAGGCGTAATTGCAGCGCTGCTGGATCTCGTACATACGCCGCATCCGACCGTCAAGGCTTTGTGCGCTC
GAGCACTACTTCGCTTTACAGTTGATGAATCACACCACTTTGCTATGGTGCATGAGGGTGTAGTGGCTGCGCTTTCACAGATTATGGCTGCAGTGACCAC
AACCACAGCGTCGCCTCTAGCTGCACCGAATGATGTCAAGCTCTTCTGCGTATTAGCGCTCGTCAATCTGTCGGATGTACCGCGTGCTGTCACGTGCGAC
GCGCTGCTGAACTCAATTATCGTGTTGGCGCGACAGGGAGACACTGCGACGCGAAGAGTATGCGCTCAGGCGCTGCTGAACCTCTCGATTCTTCCGACAA
CTCGTGGAGTAGTGGTGGACGAAGGAGCGATCGCAGCTCTTGAAGTGCTAACAGCTGTGGCGATGAGGCCCTTGCAACTCTCTCAATTGGAGGTGGTCAC
CTGTACATTGTGCAATCTGGCGGCCGTGAAGAACAACCAGGATGCACTGACGAAGAACAGCGCATTGACGATCTTGTCAGATATTATCTTAAGCGTGGGG
GCAGAGCTGCGTCGGGTGCAGACTGCGGCCAAGACTGTTGCTGATAGTGCTCAAGACGAGGCAGTAGCGAGCTCTCTGTTGATTTCAATCCGCAAGAACT
GCGTCAACTCCATCGCGATGCTCTGCTGCAACCCGAAGCTCCAAGTCCGTGTGCGCAACACTGGCTTTGTTCCGAAGCTCCTAAACATTCTTCGAGGCGC
TGACGACCAGGAAGACGATTACAGCGATGATGAAGATCACGTTTTCTCGCGTGGTATTGATCCGGAAACCGAGAAATTTGTCGTTGTGGCACTCGCGAAT
TTGGCGCTCGACGATCGCTGCCGACCTACGCTCGTGCAAGACGGAGTAGTTCCTCTTTTCCTTGGGTTATTGCGAGCTCCAGAACTCCCAGGGACTTACA
CTGAAGGCGTCGCAGATAACCAAGACGATAAAAGAGCCGCTGCTTTGCTACTTAAGTTGGATTGCGTCACGGCATTGAGCAACTTGCTGCTTCATCCAGC
CAATTTTCAGGCGTTAGTGGATGCAGGTGTAGTTCCTGCGTTTTTGGATCTTATCCGTAGCGAGGACACATCCGCTAGCAGTAGCAGCAAAGAGATCCAG
AAGGCGTGTGTGTACGCAATGCTGGGTCTCGCCAAAGACCCAGGAGTGAAGACTCGACTGGCGGAAGCTACTCAGAAGCGTCTTGATGACGAGGATTCAA
ATGACCAAGTCGGTGCAATCCCGACGATGCTGGCGTTCGCGTCGAGGAATCTGTCCAATGCTGAACTCTGCGGTGTCTGTATTAGTTTCCTACACCACTT
ATCGTCACGAGCTGTGAATCATGAGTTGCTATTCTATGAAGGTGCTGTGGGGTTAGTCGTGCGTGTGTTAAAGAAACCAAGCACAGCGGAAGCACCAGCC
ACGATATACGCGCTCTGGTTGGACTGCCTAGCAACACTGGCCCACCTCGCGTCGTACGAAGCTAAACGCTGTTCACTGCTGGACGATGGGGTTCTTGAAG
CTATCCAACACTTCCTCATCGTCTCGGCTGCGGATCAGCGACCACGCGATGCAGTGACAGACCGAAGCATCATTAAGGCCCAGTACGCTGCTTCGCAAAT
TGTCTACAAGCTGCACGAACTCTGCAGTGGAATCTCTGTGTCAGCTGGTGCCGGGCCGGTGGACGCACCCGCTTTCTTCGCGTGTTTGCTACTCTTGGCC
ACCCAGTCAGCGTCCAAGAACTCTCGATTGTCCAAGTCAACAGTTGCGCTGCAGCACCGAACAGCTAGACGAACAGCACTTACGATCGCCAAGGTGGCGC
TGGCTCTGCCACAAGGTCTAAGGCGGTTGGCGGAGCATGCTGATATTCCTCCTGCTTTGAACATGGTCATGCGTACGGGTATTCATGAGGCTCAAGTTTG
TGCTGCTGTTGCACTGTGCAACTTGGCAGCCGAGCGGCCAGCACCCGCGACAGGCAAACCCCTCTCGAGAGTATGGCGTGATGCAACGGTGGACGACTTC
ATCGTCATTACGCTACTACGAGTGAATAGTCCACAGACGAAAGGGATCTGTGCGAAGGCCCTGTTCAATCTACTGACACATGAAGACGCACGCGACCAAC
TGATGCGGGATGGCGTTCTCTACGCTCTCTTGAAGCTGGCTCGGCTTGAAAATGACTCGATCCGAGACCTGGCTCTGCGTGCTTTGTACAACATTTCTTT
GGATGCTAAGAAGACGGCGCAACTACTGGAAATGGAGCTCGTGCGGATACTGGCAAAGATGTACCAAGCGGACCTGAATAAAACGATGAAGCGGCTCATG
ATAGGCATTTTCAGCAACTTATCAAGTGCTTCTTGTGCTCTCAACGATAAAAATGCTGCTACCAATGACGAAGGTGAAGAGAAAAGTGTTGAAGGCGTTG
TGGCTACCACGAAGACTGTCGAGTTGCAGATGCTTCAGGAGGGATTACTCAGTGTCCTCAAGAACTTGGCCAAAGTGCGCGATCCTGAGATGAAGCTGTA
CGTCGCGAACGTGCTGTACAATCTATCGTGCGCTGTCGAGTCGCGCGTCGTGGAGATTCTAGCTCAAGACGAAAGCAATGTGCTGGGAATCTTGATGGCG
GAGCTCAAGTCGGAGAGCAAGGACGTGCGCAAGTACGCAGCCAAGACCCTCGCCAATCTCAGTGTTTCTTCTGTTGCTGTGCAGATTATGACTAACGATG
CGGCTTGTGCTGTGGTGAGTGTCATCAATGATACCATGAAAGGCGGAAAGACCAAAACAGGGTCGACTCCTACTGGAAGTGGGGCCTCGAGCTCGCTATC
TGTCTGCGTCGAGACAAATTGTGCTTGTGTATTTTTCCTACGCAACCTCTTTTCGTTGGAACTGAACCAGCGCAAGTTTATCGCGTGCAATGGGTTTCCA
ACTCTCGCCGCACTCCTCACAAGTCCAGCGATGGCTTCCGAAGCGCCGACTCTGCGTGTGGCTACCGACATGATCTGCTCGCTCGCTAAACTCAACGCTG
AGTCTGGCAAACCTCGAGAAATGTCGTATGAAGAGCGTCTCGTGAGAGATGGGGTTGTTCGCGCCCTCGTGGCAATGGGCAAAGGTGCAATGGATGGATC
AACCACACGGGCTGAGGAGAATGCGGCTTGTATGAACATCGTCACATCTTTAAGTAGTTTGTCAGGGCACCCACAGTGTCACGACGCCATGTTGCGTGAT
GGAGCTCTCGACGCACTCGCAGTCTTGTGTGTGACGAATCCTTCAGATAGTCGAACACCTTTTAAAGGTCTTGTCGGTGTACGTGGAGAGGCATTTGCTC
TACATTGCATGGTAGTGATTCGGAATCTGTCGCGACAAGAACCGTCTCCACCTCCGTCTGGACCGCCGTCGATGGACAGTGAGGCAGGAAATGGTGGTCG
TGCTAGTAAGGCAGAGGACGTGCGTAGTCAGAGACTGACCTCTCAACCTTCCTTAGTGCCCATCGTGTTGGCATTATCGCAATCCACTAGTCCACAAACT
CGCGAGCACGTGGTGGTCTCGCTCTACAACTTGGCTCGGTTGCGTCGTAGTAAACGGCAGATGATCAAGAATGACGCCGTTAAAGTGTTGCTACGACTTG
GAACGAGTGCTATTACGCCTTTCAAACGGCATGTCTGCTCCTTGGCGCTTCAAGCTTTGGCTACTCATGTTCCACCACCAGCTCCAGCACAGTCAAATTG
TCCCGACCCTACAGCGACTACTGTAGATGCCGCCGCCAACGCTGCTGAATGGGATGATCCTCACGTGGATAAAGTGGTTCAAGAGGGAATTGTGGCCGCA
ATCGCAGCTCTCGCAGACTCACATCAACACGATTTACTTGTCAGTGTGTCGACGAACTTGTATGTGATTACCACTCCACCTCCGGCGGTCATGGAGTCAA
TTACTTTGTTGCGTACGACGAATCGAGCGATTGAGCAGCGTGGTGCTCCTCCTGACTGGACCAAAGTGCTGATTACCGATTTGATCTCGTGGCCCGAGAT
TGAAATGGGTACCAGCAGAACCACTGCTATTCGAGTTGAGAGTAATTTGGCTTTGGGGGCGCTGTCTCCTGGATTACAAGAGGAAGATCACGGTGAGGAT
CCCTACTCTGATGCTAGCGATGATGAAAGTCGACGAAAAGGCTCACAAGGTAAATCGAGTGGGAAATTATCGAGTCCAAGCTCCTCAAAGAAACAGTCAC
AGCTAGGTCACAACTCAAATTTGGCTCCCCCGCGAACATGTAGCTCGGACGCGGTGTTGGGGTCTTTTCAAATGCTGGCAGATCCGAAACCAGAGAAAGT
GCGAGTGAATGTGGAGTTTGAACTTGCAGGCCGTCGCGCTGTCACCTCGTCTCCAGCTATAGCGTCTGCATCAAGTAATGATGAACTGCCAAAACTCCGT
CCCGAGACGGCACCAGAGGGATTAACAGAAGATACTTCGAGACTTGGTGGAAGATTACAGCTCACGCGTACGCAGGCGCGCCAGGATGCTGCGTATCGAC
GATTAACCAGCAACGGAATTTATCGAGGCAACACTCCAGAGAGTCCCATTAAATCCTCGGCGGCTATCACAAAGCGGAGATCCCACCAGCTAGAACCGCT
TTCCACCCCAAATTGACATGTGAAAGGCCGAACAGTAGTTCGGGCCGAACTACTTTTCTAAAAACGGGTGTTAACCGGTCTTTTTTCTTACTTCGATTTA
TATCCCTTTTTCTCTGAATTAGAACTATGGCTTTATCAGCACTACTCGAACATACTAGGGGGAGATAATACATTTTTTTCTGAGTCGTGCAGAGTTGACT
TATCTCTGATAAGTGAATTCAAGAATGAGCGGATCTACTTTTGAGTTTAGCAGACTGAACTGCACCTAATTTTTTTTTACTTGTTGTCGTCCTTCTTATC
GGGCTTAATGTTTTGATTAACCCACTTAGTTTCTTCCTTGCCCTCTTTGACGGCTGCGAAGCGCGCAGATACGAACAGAAAATCGCTCAAACGGTTCAGA
TATCTCTGCACGACGCCGTCCACGTCACCCGCCCCAACGAGAGGCACGACGCTACGCTCAGCTCTGCGGCAAACGGCTCGAGCCACATGGAGGTGCGTCG
AGGCGAGTCCGCCCCCGGACGGAAGAATGAAGCACTTGATTAATGGCAATTTCGTGTCCATCTCGTCGATCCAGTGCTCCAGCTGCGTCACATTGGCGTC
GTTGAATGCACCAGTGCGGCGCTGTTTGGTTTCGGATGCCGAGGTCAGTGGCGTGGCCACACAGGCACCGAGGTCGAAGAGGCGGCTCTGGATTTGCTCT
AACTTGGGCGGCAGGAATGCGTTGGCAGCTACGCGCGCCTGCTCCACGGCCACGCCAATTTGAGCATTGAGCTCGTCCATATCTCCCAACGCCTGAAATA
CAGCGTCATTCTTGGGGCGTCGCTCACCCGAGAAGAGCTGGGACGTACCATTGTCACCTGTCTTAGTGTACACCTTCATGCCTCGGAAAGAGCCCAAGAT
CTGGAGTGAATTCGAGCGGGGTGCTCGCAGTGCGACAAGTAAAGGATGCATAAGTCGTTTTTCTGAATGTTTTATTTTACACACAAGAGCAGGTACAGCT
GGCAAGTATTATTAATAACAGTCAGCCAGTTGGTGATACAGTATGTTGTTATTTGTACTCTTCATAATTGGTGATACTAGGTTTTTAACCACTCACTTAA
ATGGCTTCCTGAAGCGGTTTTTAGTCGTATTAAAACAAAAAAACTGCAATATTTAGCAAGCGAATCCTTAAACTGCAGTAGCTACTCTTATTTCCCCTGC
TCCTCAGAATCGTTGGGCTTACACTTCGACTTCGACAGTTAGATATATAGGAGTTTCACAGACTCTGATCCCAAAAGTGAGGTCAGATTTAGCTAATTCG
TAGCCGTTTTACCGCTGCAGTCTCTCAAAATACGGTAAGTCATTCCGAAGTTTAAAAAAACTCGCAACCTGGCTATGCAGTAATATTGAGTTAATGACGA
GATTCATGTGGTTTTCAAGTGAAAGGGTCAATTCAATGCCACTCGTCGTATGGGATACAGATGGCACCCTAGTGATAAAAGACAAAAGCTTTGCAAAGCA
CAATACATCTCGATTTTTGAATAAGATTGGTGTCAGGACTTCTGAAGAATATTTTAATAACATTATTAAAACTTTTTATAATACTTATTCTGTACGTTTT
GAGACATTACCACCTTCTTTAAGAGCCCATGTACTGAATTAGGTTACGTGATGCCTAGAATTCAAAGGCTCACACCCCATGTGACTACGGCATGATCAGG
CCGCTCAAAAACGCACTGGCAGAAATTGCTGACGAATGGAAGGAAAAGAGACCGCGTAATTTCGTGTCGGGCGCCAACGCTAAGCCTCCAACGCGCGAAA
GAGTGATCGCGTGGATAATAATCGCGTGGGAGGCTGTTGTGCCGCGAGCCGCGCAGATTTCGCAGTTGCTTTGTAAACGGAGCTTGCTCTTGCTCGTCAT
GAGTTCTACGGCCCTGAGTGTTGCCGCCTTTTTGCTGGCGAATAGTCCTAAGAGATCGTGGACGAGGTGTGAGATGCCAGCCCCTGTGTGAAGAGGCTGC
GGCTGCGCACTTACCGACGTGCCACGTGCGGTTATACCAAGTTTACTATGATTGATGGACAAGAGCGACCGTGCCGCCGTGCTGCTCACGACGACACTGA
CTTAGGTAAAGTATGGTTTATATTAGTTTATGTATCGAATAGAACTTGCGGAGAGGCGTACTGGCTTGCGTGAGGCTTGCTCTCTCTCTCTCTCACAATT
CAATTTGCGGTTCAGCGAACCTCAGAGAGAAGAGCAAGCCCACACCAGTACTGCAGCCCTGTCGTGGCCTTTTGCCCGGCACTCACTGTGTTTACGTACC
TCTTTTGATTGCTTTACTACTTAAGTGTAAGTCTACTCTAATGGCACCTACGCTAAGAAGTGACCTACGCTTAGAGAGCAGTTCAGTGACGCGCCCTGCG
TCACCTCAGGTTATGAACCCAAATAGGGTTCATGGCTCGACAACGGACGCACCCGGTGTGGAAGATCAAAACGCTGGCGGAGTTTTGGCGAATGGGAGTC
GAGGAGCGCGCCGATTGGCTGATAATGTGGATGATGTAGCTACTGGACGTGACGATGATGTTTTGTCACACGAAGAAGCTGAACACCTTATCCGGTCATT
ATCCGGAAGTCAAGGTGGTCGATCATTGGTAGGAAATCTACTTGAAAGATTGCGAACTCGCAACTTTCCAGTTAGAAATCAGCCACCACCGCCACAAAGC
AATCCAAGTGACGGCAGCGACCCCAGCACAGGGCACAGCTCCATCCGTGATCAGATGGATGCCCCGTCACTACTTTGGCAACGAGTTACTGAGCATTTTG
AGGCGGGTGACGGCGTTAACCCTGATTACGTACGGCGCGAGCTGATGAATCATCAGCTGTAACCCAAGGAAGCTGTGACTAAGTATGTGCAAGACATTGA
TGCTATGGTACGCCGACTGCGACTAGCGAAGGGCGAGTTTGAAGAGTGGGAACATGCAAGTCTACTTATCTCGAACACGCTGTTGATGTTTCCTGAGCTG
GCACGAGAGCACTCACTCTGGATGAGCAAGCATGATCATCGGACCATGACACTTGCTGAAGCGCTACAGCGCCTGCGCACTGCGGAACACTCAAGCAACC
AGTTGCAACAGCAGATGTCACTAGCGGCGCCAAGGACAACGCAGTCAAACACGAACCAAGTGAATAATGTGAGCCAACATGCAAGACAAGGACATGCAGG
CAAGCGTCAGAGGCAGCGCAAGGGCAAGAATGCTGAGAAGAAACAGCGCTATACCTGTGCTAACTGTGACCAGCATGGCCATTGGTACGCAGAATGTACT
GCAAACACTGACATGGAACTGAAACCTGAGTTGGTACAACGACTAAAGAAGAAGAAGGCCAAGAAGCAGGCAGTCTCACTGATTAACTCCGTGCGCCGCG
TGCATACGACGCCAACGACTGGTGAGCCGCGTCGCCTGTTTGAGAACTTGGCGCTGAGATCGCCGCACCCAAGTGAAGGTGCGACTGGTGCAAGCCGTGA
GAAACGCTCGGTATCACCCATCTACTCTCCGCCATCATGTGCAAGCGATGACGATGAGACGGAGGAACGCAAAGTCGAACCGGCGAATGATGTGAGTGTA
CCGATGACGCCGCAGCAATTGCAACTTCAGCCCAGTCAAAGCATGCAACTTACCCAAGTTGAGCAACCTACTCAGGCTGTGCAAGGTGTTCAACCCAGTC
AAAGCATGCAACTTACTCAAGTTGAGCAAACTACTCAAGCTATGCAAGGTAATCAACCCAGTCAGAGTATCCAATCTGCTCAAGTCATGCAAACTGTGCA
AAGTACTCAACCTGTTCAAACAATGCAAGCCATGCAGCCGATGCAACTACTGCAACCGATGGCGAGTACTCAGCATGAGATCGGAACATCGTATGGATGG
CAGATACCGACTATGGATGCTGCGCAGCACCAATGGGGGGTTGACATTTTCTAAGACCACTTCCGACGTGGGATGCACTGTTCTACTCCTTAGGCCAGGG
ATTTTCGAGTGGATTACAGAGACCTACGTTTGAGCCAGGCCATAGAGGTGGACCACAAGTGGGTTCATCTGTACCAGGGGATAACTACCAAGGTCGTTAT
GCTGAGCCACAAGGATATCAAGGCCTTGAAGGACGACTGTACGATGGAGGATCGTATGGTGGACGGAGAGGATCGCATGGACCATCTTATGGAGGACTGT
TTGAAGGTGAGTGGCCTGTACTAAGAGAAGCACGTACCAATCAACCCGTTGACTATGGGCGAGGCTACACATCTCCTTTTGGAGGAGGAGACTGCCACCT
CGGGAGAATGTTGGACCCCCAAGATCGTCGCTACCGTGCTACTCATCGATGAGAGGTCCACCTGGGCCTCGCTACCAAGGACGTTCGCCAGATCGTGGAC
GCTCACCCGATCGTAGATATTCGCCAATTCGTGGACGCTCGCCACCTCGCGGAAACGTTAGGCCTTCATTGTCACCACCTCGCTGGCGCTCGCCGCCGAG
AAGACGTGCAGGACAGCGTCACTCGCTGCCAAGAGGACGATCACCATTGCGTGGCCCCCAGAGTCGAGGCATGTCGTCTCCTCGTGGACAACCAAGACGC
GATGGACCAGTGCAACGCAGACGTGGAGGACGCAGTCGGTCGCCACGACGGAATCAGATGAGTCACTACGGACCTCAATCTGAAGAAGGACGCCAAGGAA
GTAACAGTACCCAAGGCAATGAGACAGGTCCCAGAGGTGG