Description :
From Genome Similarity Track
Location :
Scaffold_104:102229- 104827
Transcript NameFunction/comments
Sapdi_VS20SDRG_15870hypothetical protein
Sapdi_VS20SDRG_15871hypothetical protein

Sequence
2598 bases(100 bases per row)
GCGCAGGCCCCACCCTACATTCGTATGGTACGAGAAGTAACCTTGTGCCGCTAGAAATACAATTTTGTGGCACTCAGAACTGATAGTCGGACACAGGAGC
AACGTATGGACTTTCAACAACCCTTGCGCCCCTTGTCCGACACTGTGTTGAGTTGAGGTAAGTTCGTGTCCCGCCAGCCAACAGGAAACCAGCATAAGAT
TATTCTACTAGGAGCAACGGGTATATAGTCAGTCTACCACAACGGCAGAGTGTTCGAGAGAGTGCTGAGAGTGGCTCTCTCTGGTCCTGCGATGTGCTGG
CTGCACCTGGATCAAGATCGCGAGACCAGAGGTTCAATGGTGTGAAAGATTTGACAGCGCTCGCTAGACATGCAGCACGCCCACGTCTTTGCGCTTGACG
TCTTCGGCTTCATCAGACGCGTCAGTCGCCTCATCATTCTTCAATCGACTCGTTCTCCACCACCACCACCATGGTCGCTGCCCAGCGCTCGTACTCGTTC
GCACGCACGTGGCTCTCGGACCCTGCGTGCTACCCCATCATGGGCATCATCGTCTGCGCCATCTCAGGCGGCTCGTACACCATGGCCCGCTATGCGTCGC
GCCACCCGGACGTGCAGTTCAACAAGGCCAAGCGCGAAGACATCTTCCGCTTCGAAGCGCAAGACGGCGCCGACTGGCGGGCGCACCGCTTCACGTTTGC
CAACGGAAAGCGCAACCCGATCAACCAAAGCGAGATGTTCGACCCGATGTTTGAACGCCCCGAGAACCAGCACATTTCGCGATAAGTTAACAAATAAGTT
GTTCCATGTGTACACAGAACTTGGAGACTTTGGCTACATGGACATTAGGCGGAGGTCGTATGCAACTGACGCTTGGTTTTGCGGCCGCTCGTGCCCATGC
AATCGAAGACCGCCCGTGCATAGTCGCTGCAGACTGTAATTTTTATTGATGAAGGATGGAACGGGGACTTCACGCAATGTTTTGTGCAGCGATGTCTCTG
CCAACGTCCGCCAACCGAAGAGCTTCGAGTTTGAGGTCGCACCCAACGCCTGCTACTACTCGTCGGACACCTCATATTTCTTAGTTCTAGGAAACGACGT
TCGAAAGGGGCCCATGGAGCGTGGTCGTCGTCGTGGACCCGACCGGGGCCAGAGGGTCGGCAGATGAGCCGCCGCTTGCGCAGTCCTAGCGTTAGTAAAA
ACGGAAGTATCTTTGAAGACAAAGCCTTTGTGCAAGCGACTCGACTCCGTTGCGTCCTGACCGACTCGCAACCGACACAGCGAAGAGGCTCGCAATCGCC
AACGTGCCTACGTGGGCGGCTGCGAATCGTGTTGTGAATATCACGGAAAATTGGTGCGATCCAGCCACGCACGTGGTGCGTAGTTCTATTAACAATATTG
TCTTCACGGCGTAACGCTGACTTGCCCAAAAATCCCCACTTGGTTTTTCCTCACACGATTCCGCATATGTTGCGCTGCGTGGCAAACATGCTGTGTACAT
CAGCGCCGTATGACGTAGCCACTGAATTTCGAAATGGATGACGACCGCACGTGCCTTTGTCGTCGAAACCGTAGCTTCGCAAGCCAGTGCACACCTAGCC
CTACTATGAAATTCGACAATCGCACCAACGAGGCTGCGTGGAGTAATCGCTCTGTGGTACTATGTTGCTTTCTAAATTTCTAGTTGCTAGTCGCAATAAC
AGTGTCTCGTACGAGCAGATCCAGCGCGTCCACTTGGTCGTCGTCGACAGAGGTGAGGTAGAGCACCAGCGACGCTGCCAACGCTTGGTACTTGGCCGAC
CCAGCGCGGCTGAGAAATATGAGGGTTGCGAGTCGCGCCCGTGCCTGGCTCCGACCGGCGCTGTTGGGTGCAAGCACCTCTCTCCGCAAGCTCGGGGCGG
CGTACAGTACGCTGGCAAGGTCGTTCAGGCCGAGGAAACCGCTGTGCAGGGATACAGAGAGCCCTACGAGGCGATGGCGAGCATCTCTAGGCTCGCGATA
CGCCAAGCGCTTTGCTTGTATCATCGCCGCCGGGCTCGGCCAGTACGTGGCTACGTCGTTAACATCCATCGTGGCGAGCTGGGGTGTTGTGGAGAGGAGG
CAGGGGGTTGCCCACGTCACATGGCTGCTCATGGCAGCAAGGAGCCCGAGGACGTCATCGATGGCACTCGCACGCTGGAGCACATGATGACAGACCTGCG
TCGCGGGGTCGATGAGAAGCACAACGTCGTCTGCCGGGCAGTGCAGAGCCCAGTGCGTGCGGTGCTCGATGTTGACCGACACGACACGGTCGACGTCGGT
CTCGTCGGCAGCCGAGAGCGCAAGCCGCGGTTGACGCAGCCAGTCGACGTGCGCACGCAGAGCCGTGGCCGAATCTTCCCAGTCGAGTCCTTCGAGAAAG
CCATAAAGATCGACAAGATGCACGAACCGGCGCATCCATGTGTCGCCTTCGAGCACTGTGAGCACGATGGCGTCGTCGCTGGTCCACGCCACGCACTCGA
CGTCGTCGTTGGCTGTCAAGAGCCGCGGCCGCCCGAGCCCTTCAACCCAAAGACCTTCGGGGGTCTGTGCCAACGAAAGAGCTCCTCGCGTAGCAATG