Description :
From Genome Similarity Track
Location :
contig_78:10221- 12069
Sequence
1848 bases(100 bases per row)
GGACAACTGGAACACGAATTTGCCTCGCCGCGGCGAGTCCAATCCCTCACACTCATCCATCAATGTGGCGAAGTCCGCCTCGAGATGTTAATCAACGAGC
GTCAGGTACCAGCACTTCTCCCGTTGCTCAACAGCTAGAACGCACATCTCGAGAGATACATTTTTTGTTGCAACAGGTTTTGTGTCCAAGATGAAAGCAC
GGATAGCTTCAACGGTCCGAAAAGATGGACGTGCTTCTTCCTCCTTTTGCGCCGCTCGCTCTGCTCAAATCAACTCCAACGTCGTTGGCATCAGCAGCCT
CTGATTTGTTGTTTATCGCACTAAACCCAGCCATACATTACCTCCTAAGACACATCGACCTGCACAGGGAATAATTCGATTCAATAATGAAACTAAGTTA
TAATGAACATCATCGAAATAGTTCGTGCATGGTACAACACATAGGAGATGCTGGCACTTGCCTTCCAACGGCAATGTGGATGTGCGGTGTGCAGTATGGC
ATTCGAATGAGCTCCTCGGTCGAATGGTGTAAGCCTCAACCCCATGAGTAGCGTCACGGTCAGCATCTCTGCAGTAGCGGCATCCTCCCATGAAGAGAGG
GAGAGGGGGGATGGCGACGCTTCTGGCGACGCCTCACAGGGTCATTTCTAATGTCCACTACGCATGTATGTGTGCTGCACACCCACTCATGCGGCACACC
CAAATGTCAGCTTTTTATATGTATGATTGGCTCTTCCCGCCAGAAATGACCTGCTGAGGTAGCCCCACTGGATACTTAAGCGGTTCCGTGGTTGCTCACT
TAAGTTGATTTCTATGCGCTCGCTCAATCGCGACTGTTAACTTCAGTAACACAAATCATCGTTGTACTGTGGTTTGTCGTTCAGGTTGTCAAAAGTTAGG
GCTAAATAAACGAGTATAGAAATATGTGAATTCCATTGAAGTTGGCATTTAGATACTCTGTCCCGTGCGGGATTGGGACTATAGTGAAGGCAAGATAGTC
GAAGTTTAAGACAGCTCCAAAATGTTTAGAATTTCAAGAAATTGAAGCCTGGTTGAAGTTTCTATCCCCGGGCTTCGTTATGCTCTCAGCCTTAAGCTGA
GAGAATAAGTCACTACTATACACTATTAGTATACAGACACAGCGTTGGCGCTTGCAAGGAGACCGAAGATTGATACGATTAGGAGATGCAGACGCATTGG
GAAGCTTGGGCACAGAAACGCAAATTAAGGAATGCGCTTGCAATCCAAATGAAAGACGGTGAACCTGACAGCCTGTCCACAATCTGGACAGGCATTGGAG
CGATTCCCGCAGCCATTTGAACTGGTTCAGATCCAAAATTTGCCCTACCCCATACATAAAAAACATTATAATCTTCAAGTGTTCAAAGGCAGTGGTTCAG
ACTTAAAATCTGGGCTTTGGAGGATAAAATGACCTCAATTAAGCGCTCTACCTGTCAATCTTGATGACTTCAACTAACAAGCCACACTCTTTTTCCACAT
CAAGGTCTGGCCCTCATCAAGCTCAAAACTCCAGACTGCCCACCACGAACGCGGAGGTGGACACAGAGGCCGGGCGACAGCAGCGGAGCGAGCAGGAGCT
GGGAATATCACAACTTGGAGGCGAGTAGACGAACCTATTCAAGCCTTTGAGCTGTTATCACCAACCATAAGCATCATGGCAAGGAGCGGGAGGGTTGCAG
GTGTCGAGAATTACAGCTCCCAGGATGTGGACGTCCTCCTGGAGTTCATTAGTGACGTTCTGCCGCTCAAGAAGAAATTTCAAGAGTTGCTAAGCGTCAA
GAAGCCAACGGGGGATCCAAGGTGCCCTGAAAATGCCGTCCAATCCAG