Description :
From Genome Similarity Track
Location :
Scaffold_42:10221- 11646
Sequence
1425 bases(100 bases per row)
GCCACCAGTAGTGTTGACTCACAGAGCCATAAGTCTTTTCCCGGCCCAAATGCCCACTGAGGGCACTATCGTAGGCCCCAAAGAGGATTCGGTTCCAAAA
AACCTCATTGTGAGGCACAACAATGCGAGTGGTATCCGCTACATCTGTGCGATACCACAAAAGGCCATGATCGACGGAATATCGATGTAGACCGGCCAAG
GCCGCAAGCGTGCTGGTGATTGACTGTCCTAGTCCTTGTATTCCTCACTCCCAAGGGCATGAAACTATGCCACACATTGAGGATCCCGTGGATACCACAC
GAATGAGCTCCTCAATAGCAGACGACAAAGTCGTGACATGAGCAAGCTCATAATCAGGTCTGCAAGAGAGGGCATCTGCCAACACATTTTGTTTGCCTGG
CTTATACCTCACCTCAAAGTTATATTCCGCAAAGAAGGAAAGCCACCTAGCCATCCTCTGAGAGAGGTGAGGCGACTGTGTCGCCGTGCGTAATGATGCA
TGATCCGTGTAGACGACTAATGGCTTGGAGCCAAGCAGGTGAGCTCGAAATATGACGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAG
TTCTTTTCAGCATCTTTCAGCTGACGTGATTCAAATGCGATAACCTCTCGCGGCCTGCAGCATCTACTTGAAACATGGCACTGCCTATAGCAAAATCGGA
TGCATCGCAGACAACACTAAAAGGGTACTCAGGATTTGGCAATGCCAAAATGGGAGCATAAAGGAGACTCTCCTTTATTGCCCGAAATGCGTCAGCATGG
GTGTTGTCCCAGCACCAACCTGTGTCCTTCTTAAGGAGATCATTTAATGGTCGAGCCATATCAGGGTAATTTTCACTGTATTTGTGTAAGTAATTGGCAA
GGCCAAGCCACTTACGCAAGTCTTTTTGATTCTTAGGAATCGGCCAGTCCACTATAGCCTTGACCTTAGCGGGATCCGCTCTAAGGCCGCGCTTACCAAT
GAAAAATCCTAGAAAAGGAATCTACTCTGCACCAAAAATGCATTTAGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCACGGCTCGCAAA
TGACCGATGTGATTTTCAACATCTGACCGACATTTTTCGGCACGACTATGGACAAAAGTGTCACAAAAGTACGTCTGTGCGTAATCCTTATGTGGGCGGA
AAAGTTGCGTCACCAGACGATTAAATGTTGCCGGATAGACAGCCCTTGGGGCATCACCAGCCATTCCCATAGCATACCACTCGGGGTTCTTACTGCTGTA
AACGGAATATCACTCGCTCGCATGAGCAATTGATAATATGCATCGACCAAGTCGAGTGCACTATAAATAGTACAACCAACCATGTTGGTTTGGAGAACAT
CCTTTCGAGGAATGGGTGTCTGTGC