Description :
From Genome Similarity Track
Location :
scaffold_214:1022- 4069
Sequence
3047 bases(100 bases per row)
TGTGCTTCGACTTTCTCGAGACTCAGGACCGGAGGAGGATCGTGATCTGCGGCGACTCCAACCTGGTGATCCGCCAGATGCGTGGCGAGATCGACCGCAA
GGCGCCTGGATTACAACTGCTCCGGAAGAAGGCGATGGATCGGCTAGGATCCTGGTCCGATCACGAGTTCCTACATGTGAAACGCGAGTGGAACCAGAGC
GCAGACAGGTTAGCAAACGCAGCTCTCCAACGTCAGGAAGGAGAGATCGTTACCTCGGATGAAGATCGCCACGACCTGATCACACTCAACCGTCTGGACG
AGATGCTGAAGCCGAAGTCAGCCGACACCATCGCCCACGTGACCGCAGTCACCCGACCTGCGCGCGGTCGATCTCGATCGCCGAAGGTGCTAGAGGAAGC
TATCGTCCAAAGCATGCGGAGTCAGCGTATTCGAGAAGCACAGGACGAGGAGAAGTGGATATCGGACATGAAGGCGTATCTGAAAGGCGACCTGCACAAG
TTGACGGCGGAAGAGGCGAAGTTTTGCTCCAAGATCGCAGATGACTACGAAGTTGACGAGGCCGGCCTGCTGTTCTTCTGTCCAAGGACGATCAAGCGGG
GCGAAGACCGCGACCTGGTCGTCTGCCTGGTGGTGCCGGAGCGACTGCAACAGGACCTGCACCATTATCATTCCAGTTTAGAGGGCAGACATCAAGGCAT
CGGGAGGACGTACCTGCGCATTCGGGCTCACTTCCACTGGAGAGGCTTGTACCGGAGCGTGCAACGCTATGTGGGACAGTGTACGGACTGTGAGACCTGT
AAGGGTCGCCCCTTCGTACAAGGAGAGTCCCCTGGGAACATCCTGGCTACGTACCTGTTTCAAGCTATCTCGATGGATCACATCTCCTCGCTACCCTGAT
CGTTCAAGGGCAACACCAAGTTGCTGATTTGGGCCGACCTGTTCTCCGGGTACGTGGTCGCGAAGGCAACTTCATCGAGAGAGGCGCAGACGGTGGCGGA
GGGCTACGAGGAGTGCGTTTTCCGACGTTTCGGAGCCAGTGAAGTTATCCGGCATGATCGTGAGCCCGGGTTTATGGCCGACTTTTTTCGAGCATTCAAT
CGCATGGTGCAGATGAGGCAGAGTCCGACAATGGCGTACCGTCCACAGGCCAACGGGAACGCGGAAAGAACAGTGCAGACCCTGACGCGCGCCTTGAAGA
TGTACATCGCAGACGTGAACCAGCAGGATTGGGATGACTACGCAGAGCGCCTGACATTCGCCCTCAACACGGCTCAAGACCGAGTCCGCGAGGATACATC
GTTCTATTTGGTGCATGGTTGGGACCCGCGATCAACGTTGGAGGCAACGGTACCTCTGGGATCGACGAGGCGTCGAGATTGCGAACCGCGAAGATGGCGG
TACCACGTGCAGAAGCAGTATCAGCGTGCCAGGGAAGTGGTAAATGAGCGACTGCGGCAAGCCATCCAAGCGCGAGCAGATCGCCACAATGAAGAGATTC
GTCCGCACAAGATTGACGAGAGAATGCAAGTGTGACTATATCTGGATCGAGTCAAGGAGGGCTATGCGCGCAAGTTAGCGCACATGTGGCATGACCCCTT
CCGCGTGACCGAGATGATCGGTGATCACGCTGCACGTCTCGAAATTACCGGAATCGGATACCGCATCTTTCCGATAGTTCACCTCTCCAAGCTGAAGCCA
GTGAAGACATTCCCAGATCGTCCCAAGGTGACACTAACGGTTGACGAAGCTGATCGCGTTGATTTCGACGAGGAGCTCCTACCGGAAGACAGTTGGGAGC
GCCCGTTGGATGCAGACGAATACGAGGTCGAAGCGATCCTGGATGTGCGATCGGAACGACGCACTCGATATGGGCGTGTTCACCGAGAGTTCCAAGTCCG
TTGGAAGGGGTACGAAGAGCCAACATGGGTCGACGAAGCCGATCTGAACTGTGGAGCACTACTGCGGGAGTTTGAGCGGAAGGTCACGGTTCGCAAGTGA
TGCAATCCCAAGAAGGGCAGGCGTGACACCTCACGACGGTTGGCCGTTGTGAGGGGAGGAGTGGCTGAAGAGTGAGCGGGGTGGCCGCTCACTAAGGAGG
AAGGGTTGGATGTCAACGCGTGTACTAGCCAATATCTTCGGCTATATGACTCAAGAAAAACAAGGGACTCAACACGACGAAGGAAGATCAAGGACATGCA
TTAAGGTTAACTCGCAACTACCTACGCTACCTAATGCGCGTCGGGACGAAACTTGTCGGCAAGGCGCCGGATGCGGTGGCCAGGGTGATCGGCTGGGTGA
TCGCAGTAGTGGTTGCGCCACGGATCGGCGCGATCCGCATGACAAAGAGCTTCCACCAAAGTCGTTGGCCGCGGATTCATGCCGAGTCCAGGATACCAGG
TCGTCCGCTCGTTGGTTCGCGGGAAGTGAAGGAAGAAGGATCGAGCAAGATGTCGAGATCCCAGGAACTGGCGATCAAACCACGAAGTACGATCTGCAAG
AAAGCTTTCCACCGAGCTCCAACGCGAGATCACCGCTGCTTACGCCCCACGTAGAGTCGCGCGAAAGATGGAGTGTGCTGCGAGCGCGGCGTCGCGATCG
GCAGCGAATGGGTTGACTCCCAGTAAGCCTGGCGGTGCTCATCTTCAAAGGCGATGTACGCCCGCACGAGAGGTTCAACCCCCCGGCGATGTCAAATGAT
CGGGGATTGACCGGAGTATTAAGTGCCTCCCAAGGCTGCTCTGCGAGGAGCGCCGCGATGTTGATTTCGGTGAGCAGTTCGGGTGACCAGTATTGTTCTT
TCACGACAGGGACTTGCGACCGAAGTGGGTACATCCACCCGGAAGGGGTGCCAAACTGGAGAAAAAGTTTATCCAGAGTCAACTCGGCGACGCTTGCAGC
GAGTGTGTCTGGTAGTGGCCACGGAGCCACATCTGCGCTGCGGTACCGCCGAGGAGCGCGGTACCCAGGCAGCCAGTCGCTACGCGGCAAAAAACTGCTG
TGCCCGGCAACTGCGCTAGCTCCATGTCTGTGAGTAGTAAGTTGACT