Description :
From Genome Similarity Track
Location :
Scaffold_516:1022- 2752
Transcript NameFunction/comments
Phypl_g9069hypothetical protein PHYSODRAFT_337674

Sequence
1730 bases(100 bases per row)
GAAATAATCGTGCAACGAATGAGAGGTGAGCGCATTGTTCGTGCTCAGAACGAAGAGAAGCGTATCGCAGACATGGAGGCATACTTTCGGAGCGACGTGA
CCGATCTTAACACCGCTGAAACCAAGTCCTGCGCCAATATCGCAGACGACTACGATCTGGATGTGAACGAGCCGCAATTCTTCTGTTCAGTGGCCAGGCA
GACTGGTGAAGATCGGGACTCGATCGGGCGGCTGATGGTACCTGACACGTTGCAACAAGACCTCCTCTATCACAACCATGCTAGCCTGGAAGGTGGACAC
CAAGGTATCGGGAGGACTTACCAGCGGATCGGGAAGCACTTTCACTTGAGAGGCCTATGTCGGAGTGTCCAACGGTTTCTGGGAGAATACGTTGATTGTG
AGACTGGGAAAGGGCGACCACTCATCCGGGAGGAATCACCGGGAGCATGCGAGCCACGTACCCGTTTCAGATTGTCGCGACAGACCACATCCCGTCGCTG
CCGAAGTCGTTCAAGGGGAACACCGAGCTCTTGATCTGGGTTGACTTGTTCACCGGGTACTTGATCGCGAAGGCGAGCGCTTCGCACACCGCGCAAACGA
TCACGGAGAACTACGAAGAGTGCGTGTTTCGGCATTTTGGAGCGAGTGAGGCAACCCAGCACGATCGTGAACCGGGTTTTATGTCCGAGTTTTCCGGGTT
TTCAACCGTATAGTAGGCCAGCGGCAGagggcgacgatggcgtaTCGATCGCAGGCAATGGCACGGCGGGGCGCACGATACAGACACGGACGCGCACGCT
CAATATGTATGTGGCTGAAGTCAACCAGAAGGACTGAGACGAGTACGCGGAGCGTCTCACGTTCGCGTTGAACACCACACAGGATCGGGAACGAGGCGAC
ACCCCATTCTACCTGATCCATGACTGGGACCCGAGGTCAACGCTGGAAACGTCTCTGCCGCTAGGAAGCACGCGCCATTGCGATCTAGATCGGCGTCGGT
GGCTATATCACGTACAGCTGCAATACCGGCGTGCTCGCGAGCAGGACAGCGGGCGTCTTCGAGAAGCCACCCGAGCCGACCAACACAATTACGAGATGCG
GCTGCATGAGATTGAGGCCGGATCGCAGGTCTGGCTGTTCTTAGATCGAGTGAAGGAAGGctacacgaagaagctggtgcacATGTGGCATGGGCCGTTC
CGCGTAGCAGAGATGGTGGATCGGTATGCTGCCCGGTTGGAGATCGCCGGTTCCGAGTACCGCATCTTTCCGATGGTGCACGTGTCCATGCTAAAGCTGG
TCAGGAATTTTCTGGATCGACCAGGTATGTCGCTCACCGTGGGCGAGTCTGAGCGTGTTGACTTCGATGAGGCCCTACTGTCGGAAGACAGCTGGAAGAG
GACGCTTGACGAAGATGAGTTCGAAGTCGAGCGGGTCGCAGACGTTCGATCGGAGCGGAAAACGCGGTATGGGTGGGTTCATCGGGAGTTCCAAGTGTTC
TGGAAGGGGTATCACGGAATGGCATGAGTGGACGAAGCGAACTTGAACTgtggcgcgctgctgcgcgagttTGAGCGAGAGAGTGTCAGTCGGAATTGGT
TCGAGATGATGCAGTCCCACGAAGAGGGTGCGGGCGACTCTTCGCAGTAAgttggctgctgcgaagGAGGAGTGAGCGAGTAACGAGTGTGCGGGGTGGC
CGCACATTACGTGGAAGGTTTACTTGTGAA