Description :
From Genome Similarity Track
Location :
Scaffold_36:1022- 2541
Sequence
1519 bases(100 bases per row)
GACCGTCGCCAACGATCACGTGAAAAGAGTTTGGAGGAGTGAAACCACATGATCGTCCAGCTCCTCAACATGGGCAAGTCGAACGATGAAGTCGATGCCG
TTCTCAAACGCATTCTCCCAGCTTAGGTCGGAAGAAACTTCACGTCTTTCAATTAGCCTGTGTAGTTGGCTCAGGTATTTTGGGCGTATGGGTGACTTAC
TACTCCCCGTAAATAACAGCTCTCTTAATGATTCTCGTCTCTTCACACCCTCGCTTTTGCTTGATGGTTCAGCATTGAACAATAGTGCTGATAATCTTCT
TTCCTCTTCAGCGTCGGGGATACTTGCATCATCCCACTCGTCCGATCGGTCAAGGCCAATGTTATGGAGAAGTACACATGCCGGGATGTGGTTGTTAACG
AACTTAAACTCACTCACAGTCTTAAGCTGCGTTCGAATGCTCTTTAACGACATCCACCGATTTTTCCAGAGACCAACGCAGTTCTCATTTAGGACCCGAG
CACTCGACACCACCTCATTGAACACCTTGTTGTCAGGATGGTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN