Description :
From Genome Similarity Track
Location :
Scaffold_87:102194- 104178
Sequence
1984 bases(100 bases per row)
TGTGGGGAGTATGTGTTTTCGCGATTTGTATCCGTTTAGAATCGAGTAAATCCGAATCGACGAAATGGAGACTGAATGTGGGAGTCCCGGTATTGCAAGA
TGACATGCTTCTGCTCGTACGTGTACCTCGAGTATTTGTACTCTTTGGGCTTGCGCCGCGTGGTCGAGGCATGCCGTCAAATTTTCTGTGATTGGGTGTG
GTGTTTCAGATTTCAAAACCCTTCGTTCAAATTGTCATTTTCAAATATCGCGCCACTACGTGGATATAATATATAAAAGGGTATGCATATCTGGAGGGAT
CACCAATGGAGCAAATCAAAATTTTAGAGGTTGCCAAACGGTGTACAGTGTACCACACTCAACATTGAGTCGTAAAATGCTGTGGGTGAATATGATCACC
CGACACCGTGCACAAGTGTATTTGGTGGGTTCCTAGGTACAGTAAGTACAGTAATAGTTTATGTTGACCCGCATACTACAATGTAGTACGAACGATCAGC
TTTGAAATAGTTACTGTACATGTAGTGTATCGGCCCAGATAATTGCGCAGCGTAGATCGTGTAAAACGTTATAATTTTGTGCAGCCACAGGCGGTGACTT
GGCGAGGAGTGTACTCCAATCGTGTACGTCACAGAATGATCTACAGTACACGTATCGATCAGCGGCAGGCCGTAGGCAGTGTCGCTAACTAAGACGAAGT
ACTTTTCCTTGGTGTTTGTATTGATCACCAATTAATGGGTTCGTGTTAAGTACGCCTAGGTATTTCATATGGTTTCCACAGTGGCCGGGAATTACCTGAA
TCACCTTACATGTAGTACTTTCTTTAGCTCTCGGTGGATGCACCCCTACCCTTGTCAACCCAAGCAACTGTCAAACCTTGTACAACAGACTAGTACAGTG
TACAGTACTCCCCCGCAATAGTGAACCCTTCTGGCGCAGACGTTTTTAGAGGTATCACAGGAAGACAGTTATTAAAATAAAGGGTACGTACCTTACACCA
CCTGATTGGCTTCTGATGCACAATGGATATCAAATTCGGATTCAGGAGAGGGTTGATAGCCTGGAAAAAGACAAAACGCACGCCAAGGACAACGTACACT
TGAGTTCGATTAAAGGTTACGCATATTTTCAATCAATTCGTGCACGATGGAGCCAACCATTCGAAAAATTCATACCTAGGAGCTGGCTGGGCTCGTCGTG
GTCGCAAGCATCTCGTCACGGATTTGCATGGCTTTGACACGGATGGATGGTCGGCCCACTTACAATGGGGAACCTCCATTCCTCGCATTTCCGAATACAT
TTAATTAGTTTGGCTTCTAGCTTTGGTGTGCGGGGTTGGTGCTTGGATTTATATGTCGGGTGTATGCCCTCGACGTCCACCATGGAGTTGAGCCACGCTG
GCATGGTTGACTTAACCCATTGGCGCAACTCAATCCCTTTGATATGCAGTATTCCACTTGAGCTTCTTATGCTCAATTGTCAGCCGGATCCTCGACGCTG
GTGACGGCATTTGTTCCTCAGGTGGTTTGTGTGTGTTTTGAATTTTGAAACGCCTCTACAATTTTATTGCTGATTACCTCAAAAATGTTATTAGGTTTTG
TGGGATATAATGTTTTAGTGGGTTTACTATTGCGGGGGAGTAATGTTCTAGCACTACGTTCTTTAAGTACAGTCTGTAAATCAGATATCAGTTTAAGAAT
CATAGATATCATCAGATGGTGTATCACGTGAACAAATAATTCCCTCATTAAAATAGTACTAACTAGAACTAGTAGTACAGTTCTAGTAATCACTCTTTTT
TTACCCGAAATGCTGTTTCAATGATGGAATAATTATCACACTTTTTAGCCCGTCGCTGGAATCCGTCCTACCCCTGATGAGCACATACGGTGCTAAGTCC
CCGGGGTTAACTGCATCACCAGAGGTTAGATATGGTTAACCACCGAGATGCACGTAACACCTCATAAAGGTCAGAGAATACAAA