Description :
From Genome Similarity Track
Location :
Scaffold_175:10218- 13624
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_175-snap-gene-0.18NADH dehydrogenase
Pytir_DAOMBR486fgenesh_masked-pir_contig_175-abinit-gene-0.53GE23282

Sequence
3406 bases(100 bases per row)
AAAAAAAAACTGGCAAGGACCTGCCTGTGTAAGGTANNNNNNNNNNNNAGGTCCTTGCCATGTTTTCCTTGACAACACATATTATGTGTCGTCAATTCTT
TTGCAGCCGTGGATGGTGCCAACCTTTGTACAGTTCTATAGACTGCTAATATCGGAATGAATCTGATGAAGAGCGGGAGGTTGTTGCCAGTACTTCTTCG
GATGCCTATCAACCAAAGAATAACAGTGGTGCAAAATGTTACGTGAAATGTCGCTGGTGAGAGTCTACGGAACAATGTTGCTTAATGAACTGCTAAAAGT
TACTCGAATGATGCAGGTATTCGTGTCATCTGAAGTGACGTGAACGATTGTGAGCTCTTCAGCCAAGTCCTCATAGCGTCTTGATTCTCGAGTCATGGAC
CTCCAACAGTAGGTCGATTGCGATCTCGAAGCGCAAACAATAGTGTGTGTGGCGTTTGCTGCTTCCTTCCTCACTCAAACTCGAATGAGAACTATCTGGG
TCAGTGACTACTGTCAAATAGCACTTGTGAAGAGTCAACGGGGTTGCTACCGACGGCATGCTCTCTATTGACCGAAATCTCTCTCGCTACAGATTCAAAT
CGGGTGCTAGTCCCTTCCGCTTCGAGTCTTGCGCTTACGAGTAGCTCCTACTTTGGTTAGATAAGGCATTCTGTCCTGGGGTGTCGAGCTGGGATACGAA
AGCAGCTCCATTTCGTGTGGCTTTGTTCACGCGCTGCGGGATCAAAAGCACGCCCTGTAGACGACGGTCTCACCTCAAAAACAGAAACACGACGCACTGG
GTTCGCTGACGGACGTCTTCAAGACGATTGAGCATCATCGCCGCTCTACTTCAATTCCCACTCCGTGTTTTTCAGGCGCATGGGAACGCCGTCAAGATTC
GAATTGTATCAGTGCACTTACGAGGTTTGAAGGCAAAACACACACAGACGACACATTTAAGAGTGTGCTCACGTGCTTGTGATGAGGCTATGAAAGAAGG
TGCGTGAGCAAGGAAATACCAGGCATCGGCTGCTTTACATGTAATCGCTGTATAGCAAATCTCGGCACTCCATTTTCATTTCCTCGCTTGCTTTTCTGAG
CATGATCCCACCTGCTCAAAAATACATTTTGATTGAACCAATTTTTGTATGTTAAAATTGACTGTATTATTGTCAAATTTTATATGTTTTCTCAATTGAT
AGCAACTGTCGGCGTCGCCCACCCTATCACACTAAAACCCGACCCACGCCGCTCAACCCGGCCCGTCCCGCATTCTGGCGGTCCCCTGGCGCTTTCAACT
CCCCTCTGCCCTCCGTTTGCTGTGTGTGTGGAGTTGCGCTATTCGAGTGTGATACTCTACGAGAAGCTCCGCAGGACCGGCCGAACGAACCATGAACGCC
CTGCTGCTGCGTCGTTCGCTCCTCGCGGCCCAGAAGACTGCGGCGCCGTCGGCGTCCACCGCGCTCGTGTCGCGCTCGTTCGCGACCGCATCCCCTGTGC
GCAACAGCGACGACAGCAGCGACGCGATCGAGAAGCCCAAGTGGAACGATGTGGTCGAGAAGGCGGCCAACCTCTTCTTCCTGGGCGAGATCTTCCGCGC
GACGTGGCTCGCGCTCGAAGTGCACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGTGACCATCAACTACCCGTTCGAGAAGGGTCCGTTGAGCCCG
CGCTTTCGTGGCGAACACGCGCTCCGTCGCTACCCAAGCGGCGAAGAACGGTACGGATGTGAACGCATTACTACGCGTCGATTCTGTTGTATGACTCGCT
CTGATTGAGAGAATGAAGATGCTAATAATGTGCTGTTTCTTTGTTGTGCAGATGCATTGCGTGCAAGCTCTGCGAAGCGATTTGCCCAGCCCAAGCTATT
ACTATTGAGGCCGTACGTTAAACAAGCCAGCGTCTATGGTGTTCCATTCATTTGCGGTGGTCCATTTTGCTAATTCCTCACACACACTTTTATCTCTTTC
TAATTGCTACTAGGAACCGCGTGCGGATGGTAGTCGTCGTACCACTCGCTACGACATCGACATGACCAAGTGCATCTACTGCGGCTTCTGCCAGGAGGCG
TGTCCCGTGGACGCGATCGTCGAGGGCCCGAACTTTGAGTTTGCGACCGAGACCCACGAAGAGCTGCTCTACGACAAGGCCAAGCTACTTGCGAACGGCG
ACAAGTGGGAGTTTGAGATCGCGCACAACCTCGCGGTCGAACAGCTCTACCGTTAAAATAAAGCCGAGACGAGCGAGCACAACAGCGGCAACCTGATACA
CACTCAAGATACATGACCAAGTCGTGATAGCTTTGAGCTGCTGTTGTTGCGTTGCTGTCTGCTTCACTGAATAAAAAAAGCGTATAAAGAGAAATATTCA
CCAAATGAGAGCTAGCCCCAGAGCCCATTCAGTGAAGCGCTACGCACGCTTGTGCCATTCTCATTGATGCGCACTTACTTGTATTCTTATTATATTGCGA
CTCTGTCGCTAATCGTTATGGCTCGGGCGGCGCAATCGTGAACTTGATCTTCTTGGTGGTTTGCCCCACGTACTGATACTTGTCCTCGGGCGTTTTGCTG
ATCGTGTCGTAGAAGAAATTCGTACCGACGGTCTCTTCGAGCTGTCCGTAGAGCGTGTACTCGCCGATCTGCAGCATGGGCGACGCCGTGTCGATACCCT
TCGTGGTTGTCACCGTACAGTCAATGCCGAATGATAAGCCCATTGTTAGCGCCACTGCTCAACAACGCGCAATGAAAGCTAGGATGCACGTACCTCGATG
CGAATGCTTTTGTAGTCGTCGAAGATCGGGTGGTTCTTGAAATCCGTCAGCTCCAGCACAACCAGCACGTCCTCCTCCTCTTCGTCATCGTCATCGCCAT
CACTGTGTTCTGCGTCTTGCGCACTGCTGCCATTTGTATGCTGCTGTATGCTCGCGTCATGATGCTGGGCCCTCTTCTCTTCTTTCTCTTCTTCGTCAGC
GTGAACACCATTGACGCCATTGACCAACAGATCGTCGCTCCTCTCGCTTTCTTTGTGTTCCTCTTCATCGTCACGACCGTTCACATACTGATTGTGTCTG
TTGTCTGCCGTAGTGCCCGTGTCATTGCTAACACCATTCACACGCCTTGTGCTTTGTTGATCAGCGCCAACGCTAACGTCAACAGTAGCAGCGTCGCCTT
CCGACCGCCTCCGCTTGCGCTCGCTCGTGTGCGCTGCTGCCATCTCAACCATTTTCCTCACTGGCGACACCAATCCTCTTTGTTGTGTGTAAAATTGTCC
AATACCCTGTATAATATAACCATGTTTTAAGCGAGTAAATATAGTTTCATGAAAACCTCTTCTAATTGCATACAGCTCAGGCTCTCTCTTTATGAACCAT
TCAAAA