Description :
From Genome Similarity Track
Location :
Scaffold_963:10216- 11376
Sequence
1160 bases(100 bases per row)
GAAGATGGATGAATGAAGGGTGTGTATGTAAATAGAAGGACACAATGAGGTGGGTTGAGTGTAGGAAAAACAGATGAAGAGTTTGAAGGTGGATATATGA
GAAGTGTGTATTAAAATGTTGTGGGTAGATGAATAAAAAAAAAGGGTGGAGGAAAAGGAGAAATAGTTAAGGTAGGATGGATTGGAATAAGATAAAGATA
TAATTTAAGGTGAAGAAGTTGGTTAAGGTTTGAAAGAAGGAAATAAGTAAGAGTAAATAGAGAGTGTGTGAAAATGGTTTGAATGTGTATATGAAGAGTA
TACAGAAGTAGAATGGGTAGATATATATAGTAAATGAATGAGAAAGAAGTATGGTGTGAGGTGGATGTGGTGGTTATAGAGAGTAAGAAAGGTGTTGATG
TGGAGTGTTATGAAAGTGGAATAGGTGGCGATGTGATAATTGGGGAAAGTGTATGTTGGAATATTGTATTTAAAGTGTGTAAAAATGTGAAAAAGTAGGA
ATTGAAGTGATATGGAGTTAGAAAAAAGGTGGAGTATATGTGAAAGGGTGCAATATGTGGTGTAATGTGAGGTAGTAGAAGAAGAAGAAAAATGAATTGT
TAATATTGGTGTTGATAAGAGTTGGTAATTGATTTTTTTTTGGTAAAAATAGGGTTTGTAGAAAGTAGGGTTTGAAATAGCATAGTAGGGTTTGAAAGAG
AAAATAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGG
TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGGTTAGGGTTTAGGGTT
TAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGCTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTA
GGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTATGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGG
GTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTTAGGGTTTAGGGTTTAGGGTT