Description :
From Genome Similarity Track
Location :
Scaffold_42:102153- 103228
Transcript NameFunction/comments
Phyke_g2253hypothetical protein PHYSODRAFT_298513

Sequence
1075 bases(100 bases per row)
TCCTTTTCCTGGGACTTTTGCCCCCAATCATCCTTGAGGCTGGCTTCAACACTCAACGCAAAGGCTTTTTCTCCAATTTTATGGCAATTTTACTTCTAGC
AATCGTCGGGACGCTGATTGCAACTTTTGTCACTGGAGGAGTTCTCATTTGGCTGGGGAGCTATGGCCTCATTACACAACTGACGTCGGCCGAAGCTTTC
CTTTACGGTTCTCTAATCTCCGCAATTGACCCAGTTGCGACTTTGCTGGTGTTCAAGAAATGCCGCGCGCCGTCTCTGTTGTTTAACCTGGTGTTTGGAG
AAAGTGTGCTAAACGACGCGGTGGCAATCGTGATTTTCGCTCTTTTCCAGGAATTTGTGAAAAGCGGCAATACTGACGTCAACATTGAAGTGGCAATAAC
TATGGTTCTGCGGCTGTTAAGTATTGGTGTGGGCTCGGTTGCTCTTTCTGGAGCAATTTGTTACTCGTCCGCTTTCTTTTTGAAGCACTCGGATCCgtct
ctgcagcaacacccGATTTACGAGATTTCCATTATTTTACTGAGTTGCTACGCCAGTTATTTCGCTGCAGACCTTTTTGGCTTAAGTGGACTGCTGGCGG
TGTTTTTCAGTGGAGTGTTTATCCGACATTACCACATGTACAACATCTCCAAGGCGAGTGCATTCGCGTTTAGGCAATTGTTGGCGACAATGGCTTTTCT
GGCGGAAAACTTTATCTATCTCTATCTCGGATTGAGTGTTTTCGCCTATCGCGACTCGTTCATTTGGGACTGGGGGTTTATTTTCGCCAATTTCGGAGCT
TGTATCTTGGCTCGAGCGTTTAACACATTTCCATTGTGTTCGTTGGCAAATTGTGGACGAACCAAGAGCCAAAAAATCCCTTTTACGTATATGCTCGTCA
TTTGGTTCTCAGGACTTCGAGGGGCCATCGCGTTTGCGCTGGTGCTAAACGTGTCAACAGGGAACCCCATTCACGCTGCAATACTCAAGAGTTCGACGCT
GTTTATGGTACTTTTCACCACGGTCTTTTTCGGGATGGCAACAGGTCCAATGTTACGCGGTTTGCGACTAACTGG