Description :
From Genome Similarity Track
Location :
contig_65:102149- 103528
Transcript NameFunction/comments
g11746.t1XP_009526009.1 hypothetical protein PHYSODRAFT_499448 [Phytophthora sojae

Sequence
1379 bases(100 bases per row)
AGCATGAAGGCGTGGCAGATCCAGTCGCAGGGGCTCATCGTGCTGCTGTGCCTCGTGAACCTGCTCAACTACGTCGACCGCGGTATCATCCCGGGAGCCC
CTCAAAGCTTCCGCCACTTCATCACGTCGTCACTGGGCGTGGCGGTCACGGGCCAGTCCGTGTACTTTGGGCTACTGTCGTCGGCATTCATCATCGGGCA
CTCGGTTTTGTCGATCGTGTTCGGGTACTTCGCACTCACGCACCGGCCGTTCCGGATCATTTCACTGGGGACGAGTGTCTGGATCGTGGCCATCGTCATC
TGCGCCATCTCGGAGCATGTCGACAGCTACGCACTGCTGATTGTCGGTCGAGTGCTCAGTGGCGTCGGGGAAGCTTCGTTCCAGTGTGTGGCGCCCCCGT
TCATCGACCGTCACGCACCGCCTGCACGTCGGTCGCTCTACGTGGGGATCTACTTGGCGTCGGTCATTGTGGGCACCGCCATCGGCTTCGTGTACGGCTC
GTTGTTCGCTGAGTCGGCGTTGACGTGGGCCGGCGCCTTCTACTTTGAAGCCATCCTGATGGCGTGTCTGGTCTTCTGCTGCTTGTTCTGCGTGCCGGAC
GAGCTCAACGTCGTGCCACCGACAGACGACGCAGTGGCATTGAGGAAGCCGCTGGCGTCGACGAACGAGTTCGCGAGCGAAGTCCTGTCGTGGTCCAGAG
AGTCTCGCGAGACAATTGACAAGAACCACGCAGAACTGCTGTCACCCGAGGAATTCGGCGAGAAAATCGGGCCCGAGACGTTCTTCCAGACGTGGTGGGG
GATTCTGTCGGACGTCCCCTTCTTGCTGGTGGTGCTCGCGCACGGAGCGTATACGTTCACACTGGGGGTGTTCAACGCCTTTGGGCCGGACGTGTTCATT
GGCTTGGGCTTGTTCTCGGATGAGACGTCGGCGTCCTTGATCTTTGGGGGCATTGTGGCAGTGACGAGTCTCGTTGGCACGCCACTCGGTGGACTCGTGC
TGGATCGCTACACGAAGCACACCACCGTGCCGGGCAAAAGGTGCTTCATTGCGGTCTCGTCGCTCTTCGTCTACGTGACTGTCGCCGAGGTGTTCGCGCT
CATCATGTGCTTCATTTCAGACAGCAAAGGCGCCTTCCTCGCGTGCTTCACCCTCGCTCTCTTCTGCATGTGTGCACTATGGGGGCCGGAGATGGTGGCG
GTGCTGGAGCTCTTCCCTTCCTCGCGGCGATCCATGGCCATTTCAGCCAACGCAGTGATCATCCACGTCTTCGGCGACGTGCCGGCGCCAATTGTCATGG
GCGTCGTGAGAGACAAGTGGGCGCCCAACTGCGGCACGGTAGAAGACGATGGCGACGCTGTCCTCAACCCGCTGTGCAG