Description :
From Genome Similarity Track
Location :
Scaffold_326:10205- 11206
Sequence
1001 bases(100 bases per row)
GGATAGATGGCAACTTACTATTCGACAACATACTGATATTCGTAATTGTGCCCAGGTACGTTTTGTTGATTCACAATCTAATTTGATTTCTTTTTTCATC
TCATCGCGTAGCTTCCTCACTTTTAGCAACAGCTGCGCCGGTCTCTTTATCGTCAGCAACAGGTCGTGGTTAAATAGCTCTCTTTATTTGGGGCTTAAAT
TGTGGGTATGTGGTGGATATAGCAAATAGGCGTAAAAATTGGCCCCTCCTTATACATCGAGTAAACCTTTTCTCTTTGTCAGACGTCTGCAATAGTATAC
ACTCTTTTAATTTCATCGTCATGAAATCTATAGCGAGTTATAACACGATCTTGTCGTACGAAGGATATGTGTGGTCCGCGGTCTCACACGGTGTGAGTTA
TCTTTTGCAATAGTTCCGTGTTGCAAAGCAAAGGACGCTGTAGATACAAAACGATGTGAAAACTTACTCTAGTTTAAAAATGGATGAGTTAATATATAGC
TCATCCATTTTTAAACTAGAGTCGAAAAAGAAAGAGTAGTTTAAATGTTATACAATGTCTTCGATTACGAACAAATCGTCATCTCCTATAAAACTAGGCG
AGCCCGTTAGACGACATTGATGTTAATCTGAATATCAAAATTAACACATACCTTAGCGGATACTACTCTACAACAGTACGAGTGGATGTAAATTTGTCGT
TACGTTTCTTCCGATTGTACTATTTTACGGCAAACTGCTCATTTATTGGTATCAACGTTTAAACGAGTCAATTCAGCCATAGTTAATGACCGAAGCGTGC
AGTCTTAAATTGGCACGCAAGACTTCTCATGTAAGACACAGAAATGTTGGGGAAAGTTCCTAACTACGGTACGCCCTTAAGCCTAGCACTTGGTAGATGT
ACAGCAATACCGTTCCTCCAACAAGATGTTGTGATACAGAATCGTGTACGATATTACCATTGCCCGCAAAGTTGTTAGCTTCAATGCAAACTGGCTGACG
T