Description :
From Genome Similarity Track
Location :
Scaffold_314:10204- 12242
Sequence
2038 bases(100 bases per row)
AGCAAATTCGTACTTCAAGAGCGAAAGCGAAATTCGAGCAAGAAAAGGCGGAGCTCGCGCGCGCAGTGGAGACTGAAAAGCAGTGGCGACTTGAGACCGA
GCGAGAAAAGGAGCTCCTCGAGTTGAAACGAGAAGAAGAAAAACGGACCCGGCAGATAAAGGCTAATCTCACCTCTCTGCAGCACCGAAAATCGCAGATG
AAGCAGCGAATGATCGCAGACAGGCGGCAGCGAGAAGCGGCTACGAGCACGATCTGCTTCTTTGTCGAGCGCCGCATTCAAAGCTCACGCAGGAAGCTCG
CTGTTGAACAGACTCGGCTTCAAGAAGAGAGGCAGCGGCGCAAAGAGATGGAACTTCAGCAGGAGCTTCGAAAATTTCTAGTCGATGCAATCATCGACAC
GAGGTTCAAGGCCGAGAAGCTCGCAAGCGCGTGCGTCACATCAACGGCATCTTCCATCTACCAGATAAGCATCAGGCTGCGCTATAAGCACACTCGTCTG
AAGCACTTGCGCCGCTGTGTAAGCGCCAGAAAGATTCAGCGCTGCTGGCAATCGTGGAGAAGAGCGGTGAAGCAGCGCCAACTGGACCACGAGAGAGTCT
TGAAGGCTCAGTCGATGCGTCGACACACCTATGCTCGTAAAATCCAACGGAGATGGCTGCAATGGAAAGTGGAACTCATGAATCGCCAAGCCGTCGAGCA
AGAGCGTCAGGAGCGCTCCCTTGCTATCAGAAACCGCGTGTGCTGCCGTAAAATCCAACGAAGGTGGCGTCAATGGTGTGCAGAATTGGAAGAGGTGCGG
GCGCAGTGGGTGAGGGAGGAGAAGCTTGGCGCACTTTATCGGCAGGCGTGCGCTCGAAAGATACAACGGTGCTACCGCCGATGGCGACACAAGCTATTGC
AACGGCGTCTAGAAGCTGAAGCGTATCAGCGTGTGGAACAAGAGGCCTCAATTTGTCGCCGATCCTGTGCCTGCAGAATTCAGATGTGGTGGAAAAGAGC
GCTTAAGCGAAAACAGCACCAACGAGTCATGGAGATACTAGTAGAGGAGCATCGTAAGGCAGAGAAGGTTCGACAAGAGCGACTTCGACATATCCGTAAT
CGATCATTGGCGAGAACGATTCAACACCAGTGGAGAAAGTGGCGCAGAAGAGTGCACGAGCGTCAGCAAGCCGCAAAGCTGCTGGTTAAGCAGCGCCTCG
AAGCTGAACTGGCGAGCCTCGCGAAGGCAAACGACATGCGCCAACATTCGTGTGCTCGGAAAATACAGAAGCAGTGGCGACTGTGGCGAATCGCCATGGA
GGAGTGTCGAAAAGCAGCTCAGCAGTTAGCGAGAGAGTACCTTGAAGCAGAAACAACGAGACGCATGAAGCTAGAGAGTCTGCGTCAGTGTGCATGTACT
CGGAAGATTCAGAAGACCTGGCGGCAACGGCATCTTCGAGTTCAAGAGCGCCGAGAAGCTGCTGAGCGGTTAGCAACGGAGTGCCTCAAGGCAGAAGCGG
CGAGACGGTTGAAATCAGAGACAATGCGTCGACATGCGTGTGCTCGATTGATCCAGAGGAAGTGGGGGGAGTGGCGAATATCAGTAGAAGAGTGTCGAAG
AGCTGCGGAGCAGTTGGCAAGCGAGTGGCTCGAGTTGGAAATAGCGAAATGTGCGAAGATACAGAGCATGCGCCGACACGTGTGTGCGGGAAAGATCCAG
CGATGTTGGCGAAAGTGGACTGAAATATGCCGCCATGCAGAAGAGATCTCTGCTGAACTTGACAGAATCGACCGCAGGATCTGTGGTAGACGAATCTTAA
AGAGGTGGAGAGAGTGGCGAAAGAAGTGCGAAGAGATTCGAGTCGAGAATGCAGCGATTTTGATCGAGACTGTCTGGCGTGGATATTATACCCGACGCCA
CTTTGCAGCCACAAAAGTGGCGAGGCGATATGAAGAGTCTAGGTTGTACGAGCTCAAGCTCAGCGGTCTTGCTCGGAAGATTCAACGATGCTGGGGCCGA
TGGCTAAAACAAGTTATCAAGGCGAGAAGAGCTGTCGT