Description :
From Genome Similarity Track
Location :
Scaffold_65:102019- 119528
Transcript NameFunction/comments
Phyca_LT153411261conserved unknown protein
Phyca_LT153420491zinc-binding region-containing protein, partial
Phyca_LT1534554809conserved oligomeric Golgi complex subunit 8 putativ
Phyca_LT1534554810predicted protein
Phyca_LT1534510696glucose regulated protein /BiP

Sequence
17509 bases(100 bases per row)
cagttggagaagaaggtcgacagttatatgaacgatgtgatgcaacaactggatgctattcgacaaagggaagagcatgggctatctcaacgaacgggcg
ccgctttatctactgctacgggcgctgatacgttactaggtgctggcgaacacgagccagaagaagcttcttcagtggctgaaacgagttacgcgttgga
atatgccagtgacgatgattttatgaggaatcttttgaaaaggagagtcaacggagaagtgcgcagcatctacccactcctgacgcatcggttgtcgaga
aatcacgatctgaaagtacgagtaaaagtgagattcagtccgagcaagaagacgatttttatgaagaatcctttgaaaaggacagtcaattgcagactga
acagcatttacatacctccgactcttcggttgtggaggattcgcgatctaaaagcctgaccaagagtgaaattgaaagtgacattcagtctgtcgtatta
gagaaagatattgatggcgattttggaggatcaggagagaaaattacagttgagggagatttcgttgaggaaagcgcgatggaggctgcagtagattctg
aggttatgaatgaggtttcatcgagcctaagtgttgaaagcaaagcagatgagtcgatgtcagtgaattacgaagaagatttcgaggcgtcttcacccaa
agctcgagcggtgtctgatcacttgagtcaagacacagtcgaagatgaactcgaggcgtcagaaatgagagagggcagtgccttggaatctgaagtggag
gacgaagctccctccagccccactgttgaaagcaaggcggatgtgtcgatgtcggtgaattacgaagaagattttgaggtttcttcaccgaaaccgcagg
gagtgtcaaatcgtttgagtcaagacacagtcgaagatgaatttgaggcgtcaaaaagtagtgaagtgagtgcaggtgattccacgatggaggatgaagt
accgtctagccctactgttgcaagcaaagacgatgcttcaatatcgatgaattacgatgaagacttcgagtcgtcttctcctaaggctcgagcgacgtcc
aatcatctaagccaagacacagtcgaagacgaattgaaggtatcgaaaagcagtgaagagagtggaaatagtggggatatcgaggaagaggtcggtgaaa
atgacagcgctaagacaggaggagagtcggatatcggacatgtggagagcgactattattcgtcccagtttgatgatgctaacgccctgaaaagcacgaa
gacgtcagagctgcagacacaggatcaaccgaagcgagataatgtgcttacatctgtgccgaatgagctcagattgagcacgattccatcctcttcccct
gtatcagcggcgtatactgttgacctggagcgtcggaagcaagcagaggaatctttattatctctccgtctccaaacacttgaccaaaagtaccaacgtg
aattgaatcagttggaaactaccttgggtaatggtcaagacttggagacgcggaaagagactttgctgatggcattcttggcggaaaaagccaacattga
cagcttgaaggccgcctcaacggcgcgatactatcaagatctgcacacgttccggtctctgtgtttggactggccccacaccatcgccagtgagagcaat
agagggcaacctccgcccttttcaggccaaataacaagtttcgtacccgcatttgtttctccatcggtcgagattgccccaagtaaacctattatgacct
cagaggatgaccaagacacatctacccgtcatgagtatacagacgactttgggtcagataatgacgatgcagaagcgatcgacgaggagagtaacgatat
aaaagatgatactgtcgagtcacgatcgattagttcagggcactcacagatggacgacagcgtaccagaggaggaagaagaagactttgatcaagaaagt
gacggcaaatcagtttctgtacaagaagaagaacaagaaaatgattttgagcaagaaagtgaaatcaagtcaacttctgctcaagaagaagaaggatttg
aggaggaaagtgagatcaaatcatcttctgttcaagacggcgacgctttcgagcaggaaagtgaaattaagccagcttctgttcaagaagaagaagacca
agaagaaggttttggccaagaaaataatggactagtggaagaagaggaatacgaagacgaatttgattcaatgaacgaagatgcctcgacacgagaggat
gttgctgaggtagcagaaaccagcgagattggtgggcaggaggccagttgtgttgagagcgacagcgattacgatgaatacttcgcttccatcactgaga
gcacgacgatccagaaagcagacagcaccgttcctgacgagacggaggttaaagtggagggtgttgcggaggaaaagccgagtgactctggcgaaatctc
gagtggaagcgacattgaggtgcaacagatagctcccattgccgaagaagctggcaatattaccagtttgaatcagcagaaatattcagaagatgatttt
gaaagtgggcagttagatcagtgtgtgatccctcctacagagcaatctatgagccatcgaatggaccagtcaagctctgaagactcctcaatgacaaaga
tacttgtggctgaggttgctgttctacaagaggtgacaaatacaatgaaacaaacagaaagagaaggcgacaaaatagcgaaaaagaaggcaaaggtgga
ggaactcctggggatgaaagaacgacttcttaatcagcagacggagacatttcggcggagtgaagagaaacgacatgtggatactctcgccaagctcgcg
ctcggcatcgatgtggaagagaaattacgccgtgctaaggccgacatttctcagcagcttgccactgaattcgacactttgaagcaggcatatccgatgc
tcaaggtggcaagtgcagcgcccacagagacagcgccgacgccttctgtgatgagtaaattgtttggaacgagtcctaattacagagtcacaaatcgtga
ggaagtatacgcggaggagtacgaagctgaatcgttcgaagaggagctggaccagagagatgagagcgaagttcaagcatcagttgacgttgctagttat
gaggttgatgaagtggaggcagaggactccggtaacgatattttatctgaagttgctgatgacgttgctgaagatgtagttacgatggtggttgatgaag
aagaatacaaaaatgaagaacatgaagtcgattcagctccaagtgaggactacgaaaacgagtacgagaatgaatccttcgacgaggttcagtctgttcc
tgatggagatgaagaagtttctgtagtcgaagaaggagtggaactcccagtggaggatactagggaagagattgaaacgcttgaacaatctggatatagt
gaagaagacgtgtactcagacgaagctttcgacaacgcgtcagaattgtccacaaatgaggctgaaaaaccggcaactacaatagctacgcatgaatcaa
tagcaatagatcctgcgagcgctgctgaggagtacagttccaacgataaagagctgggagaagcaatagaaactgttgagatgcagctggaggagacaca
ggcggccaagtcagcagaacctgaactcgttctgaacgaaggcaaaggtctgatttcgtccatttctggttcggtatcgagggacgagatcgaagaatca
ctgacgaagagtattgaggagcgaaacgcgcggctgcaggcattaaaacagaagattgaagacaggaagagagagattcttgcagttcagaagcaagtgc
gagtagagcgacgcagggagaagatggcaacagaggaaaaggcgatgttggacgagatggaggcggtcgagcagctgttgcgtgctgacgaagcagcgtt
aaatctgttccagcaacgcaaccgattggagatgttgcatctcgaagctagagagagagagctttccactggcaggaagcgccaacagaccgtacgtgag
gaggaaattgatctcttacgcggatttgactatattgaagatgctcaaacggacggcaagcagcaacagcattctacaccagcatccagaggccacagca
gaagatttgatttactggttggatattcgtacatcgaagtagctgaacctgtcgcagttgtaatggacactccacaactgagcgagcaaccggctgaagc
aggaaaaagcgatagcggagagtatgtttgttcagctcgggacgcacgtataaaggaggtaagagagccgctgacatcttcagagcatttcggtggtgag
gaagaccttgatgatatgaaatcagatacaagtgaggttgacgaagagtttaaagaagacaaaagcagcttcgtgctggttgaacaagaatctggcactc
agttcatttctgagttggagatcgctgacgaatctattcttcagcacgactcgccggatgtgcagagcccagtggatttacttgcagattacgcgtttgt
agaaattgcagaagttgtttcatgcgtcaagttcgggcttccgagcgcagacttgcttgcagactacgactatgtggaaatagcggaaggcgtttcccag
gatgaagtgctccaaccagaagaagctactgatgcctctgctgatgaccacaatgaattcatatcgccgccaggtagcgaagatgggtatggggtgttcg
agaccgagctgaaagaagaatctgaacctgggggtgattttatggttggttgttccctaacgcaagcagagaaatcttcagtaaaatctgaagagactgt
taccgatgataacgacgctagtaacaacatcgaaagtgttgaagagtccgttgaagatgaagaagcgaacgcagtcgatgctgataccggtgcaatttat
gaactcggaccacgagtggaggttcagcaatccgatgttacccaccatgaagttgttgaccgaatgtctactctgttatacgctgacatgttccaagagc
ttgaagaaggtaagcttttaaacgaatctatgcggtgtatcctggaaactgacttgtgctctttagatatactgaatgtcatttgctcaagaagatttgt
ccaacttcagtcaggtccacaacttccaacaatgctaggagcgttgccggagagcccacagtcgacacttttcaacgatgtgataggagaggaaagtatt
gactcccgatatacagcggattggagtgtggaagaaagtgtccaagtcaggtcaccgaaaatgagtctacctagcagtgaaaatgtttctgaggaggaag
agcttgcgagtattgaagagtcaaccgcatacgctgactctttcgctgaagagagttttcttcattttaaagaagatcctgacgtcctgagagattcttc
tggtgaaagacatgaagatgttgaacaaggaggtggatcaagtgtaaaacttgataagctggaaaaacctctgattccacccaattctgagctcgcagaa
ccactaaccgagacgaaacgtgagtcagacgaagcgctgcaaagtgagcgggtggcagatgcaatatttggtgctgttttcgatgaaattgtaagctcgg
agctgcagctttggtctcgtcagccaccatttgtacctcactttcatacgtcggagtggactacaaaatgtagtgtaaagactgtagatactgcatcctc
gggtgctaaatctactcctggatcaccgacgcgaacacatattcaaaaatccagagcgagggatcaagttctaactcgaacgatcattgatcagctagag
attgtcgatgaagaggtacgatattttattacatttgagctgcattgcactgttgctaatgtcatttcttcgtaaacagattcggctccctgctttcact
acttttaacgaattctccggtgctcaggctctctatgatacagttgaaggcatcgctcatgattatttcagagcgattcagcagtcttcaacaaggatcg
acaacacttcggcgctgacactcatccgccgtagcatcaacagtgaaattagcgagctgctggctgtcagagcacaatcggagtatgaattggaccgaca
actgcaactgatttcagacgagtctggggctgattcaggacttagcagagatattttgctgtctcaaaattgcatcgtgtccaatgtgaaccgcatcgtg
gccaaggtccagtccgatctgagcagaaccaccgaagagctctcgacaccggcaactgagccaaacttactgcctcgtacaccaatccgccgcgccaaaa
gcacgtccattctctcctcactacaaactcaacaagaccgggagctgcagcaacgaattactgggatgatactcaacgacctgatgcgcgacgcagggtt
gccttgaagttgtaccaaaacgatcaccgaaatgttgtgttctgaaactttatattttgacatactgtcataatcgatattcagattgagaaccatcaat
ttgacaaaagtgtagccatcactccaatgacatctccagcggtagtgacgactctgctgcagtggcttgaggctaatggaggcgtcgacagtctgctgga
cattcgttatctggggaaactcgagggtcacggcgtgttcgcaaagcagaatctgtccagcggccaagtgacgctgcgagttccgttcaaactcacgatg
aacacggaatccgcatctcaatcggatattgcacccgtactggagaaatatccgcagattccagacgatgaggtattggcgttgcatttaatgcacgagc
gcagcaaaggcgcagactcgttcttcgccccgttcattgcgtcgctgcccaccacgttcgacttgccggttttctggtcagaactcgagttgaacgaact
tcaaggcaccaacgtgctgctattgacacgattgatgaagcagcatttgcagagggattttgataatatccaccaagcggtagtggacgatttcccagag
atttttgcgtcactgccgacaattacgttggaggactacacgtgggccatgagtgtgatctggagtcgcgcctttggagttactaggggagagaagtatc
tgcgcgtattgtgcccagcaatggatatgttcaaccacgacgtgagcttgcgcaacccactggatgacttcgtctcatttgatgaggagaagcaaatgct
gactcaccatgtgccaaacgctgttactgctggatcaccgctgcacatcagctacgggcaatactcaaatgccaagctattgtactcatacggattcgtt
gcaaaggcgaaccaccgccgtgcagtggatttctggatgaagatcccgcccaacgacccgtatctaaagctcaagcagactgttattgactcaaatgagc
ttaccaacaaccaaacatacgatttttgcggaaccctcttcaaagacgacgttgatgagaggctcctggctacgctgagagtgattctgatgaccgaaca
agaaattcgcttgtacaagaaggtaaagtttttttacgaggaaactcctgcaacttaccttcctgtggtatggtggaataggcatttgagaaggaaatgc
ttagcactcgcaatgagctcgcagtatatgaaaacctgcagaacagttgccgccgcaagctcgctaattattcgactacgtacgtgccccaggccaaagt
cattcggtgctgaactaacgtgaaatgtgttgcaaattgtcggtaacagacttgaggaggatgaagcgatcttggctgaaactgaaaccgaatcgaaccc
tcgcctggccttcgcggttcgtgtccgcattgaggacaagcaagtgtttacaggcgtcattcacaccctcgagcagtggaagcagtcgcttacatccaac
cccgagaaataccctccgagcactacacgtttgtaaagcgatcttgtacaagagaggttttgttaaatgacaattcttttagtgcatttttatttgtctg
cagcgttcagaagtaatgtatctccacactctcactgcttctcataactttagttggtcagcttgcggttgagcaactggcgcagcacactggatgtgaa
gtaaggcaaacgggcattcacctcttcgtcgttgaggaacttggcgcctccgatgtgaccatggcagtttgacgctccacaacggcagtcgaacttctcg
tccatgtcccactcgcttgtggcgtagtcaaaagacaaatgctcgccctccttgatcggcttaatggcaacaaatgacactttggcctcattttccacca
tgtcaatgcgtgtgttgggatcgcaactgtggttcacgaactcaagtccacccgtgaagtccatgtgcttgtcaggtgtgatctgcaccgtaaatcgggt
aggcttcgagtactgcatcaataaaacaaaaggaaaaaataagtcttctgtaaaaaaatatctactaaactgtaccatgagcttacaattgtgccaggtg
ccgacccaataacatcatctttcttgaagtcctgaccggcaacagctgaacgccaatgctcgttcctatgaattcatgttagtcgcttgacagaattgcg
ttttaaataggaagtacgtacaactgctcgatgtagaatcgtccgtcagagccctcagggatgtagctgagctgaccgctctgttgcgcatcgtgtccat
ggccgttgatcttcacgtgcttggcgccgtttgaagcagatgcagcagcgaaatggcgacggctaatagccccaaaggaacgcgaaactagagggacgtt
acgggtgagcatggtgattgcttcgtacgaggcgaaatagattgtggggggattgtgaagatcggataatgtcctgcgtgggatcagcagctatagtgac
gacgacgcggccacatgcttcttcctgcccgaggaaggacctgttgcgtttcggctatcaagtcgcagagtcagatcagtttgctgaactcgtttgtatg
ggtttcactatgtacgtattatttatatgagacatagtggaacctaaattgtaacgtcgcaaatgacacgtaaacgaggactaggggttgaagtttgaaa
cggccatttttgcgcttcaacgtgtttcagttttccctcagctgcgatttacaacgagattcttgatggcaacagtttactgcttcggtcttgtggctgc
ttcgagacggagtcagagatgactaagacaactcgccttgtcggtttatttaagctcattgtttctgttacgtaccggtattgtagcaaagtgattcctt
cacgccgggttctgcctcactccaacctgttgtgaacatgcacgttgacgacccttttttcgagcccatcgtatgcaaccatcatcattgtaaagtagct
gaagacaactcttacaaaatgccagactgcattgccagtggagaatctactgcctaaaaggatctcaattccagtctccacttcccactggagaaatctt
tttcttgtgtcatcgatagcaatagtgcacgaaatggtattggggtcaacatgtaatagccatcgttgcatggtttcatcccccacaagtttcaatggcg
gcacgaaaatgcgaatgtgtctctaaaatgatataataaaatttaagaaacaccaaactgccatcaaatttaaggtacaacaaatgttcactttctgatc
ttcaaaattgattacaacaaataatggcatccctaaagacttgctcgctcgaggagctcaagaaggagccatggcggctgcagattcaggccgaaaacac
tgctgagcagttacggaaccttgtgcttaagaactaccacgtattcatccaaagtaaccagtgcgccgccatcgtgaaggatgatgtaagagctggatcg
cgatccataacaattattgtgttatgtaattagtgtctaaccataattggttttgaaattaattcagttaggagaactcaaggaagagacgaccaagatc
gaagctgctatcccagcgttacaggattactgtgccaagttccaggaggaggtggcagacgttgtagccaagcacggcgacatccagtttgttttcgagc
attatttgcaggtaaaaaaacaataatgttgttattgaaagtcagtcactaaattctacgattcttgtgttatgtagttaacggagttgttggagatccc
acaattgctagaggcttgtatccataacgagctatttgactcagcgctggatgtgatccagtttgccaacgagacgttccaggctggcgatgacacaaac
gcctcgcacaatgtgataattgattgcttggtacgcgaagtagcagagatgtcgagtatcatgcgcgagagacttttacagaagctgcgtgacgacttgc
aactggctctgtgtgttcgagtcgtggggtatctccgacgccttgatgcactcattgtgaaggatggagctgcagcggtggggtcactggaatatgaaaa
tcagcttaaggaggagtttctggcctgcaggaatgtgtggctatcgtctttgagccgagggatttcgtcctccgatccgtatcaatatgtgcgttaccac
catttccaggtctacttcctggttaatgcgatatactgatgttattctgctgcatttatagatcattcaagtcatcgacattaagcgaacgagttggttc
gacatgatcacccagtactcggcgatcttcggtagcgaggtgggttcatttactctcgaaacttcacctaacgatactaacaatatgtcttacagaatgt
cgatggcaaagtggatccaccgctctgtcgctgggcgaccacaaccgttgccaactttatccatatcctcatgaagtacggatgctagcaaagatggcgt
ctgacttcagagtttgtctaactattggttcgctgtggtcaggcaattaccgaagatcgatgacttcagctccattgcaacgattatcgaacagagttta
ttcttcggggggtcgctgggtcgcgtcggtgttgactttcgagctgtgctagtcgtgtatttcgaggaccacgtgctgaacctgatgacagagtattggc
gttcagcttgccgtgagtttcaagagaatcttagcgcgcactcgttgtcagtctcaagtggttcgtcgtttacggcctcctcgaagacacctatcgtgat
tgcatcgtaccgttcgtcagtcaacggaaccagcagcaacttcccgttcgcttctcgtgctacggcggcctcttccagtggagtggactactcacctccg
cgatgcctgatgtcgtttcctttgctggcggagtttaccaacgctctgctgacttccctgaacgagttgcgactgtgtgcgatatcttccctgcagaacc
ggttggacaaaaagtaccagagtgcaattggcacgatgctactcacgatcgcagattttgttgagcacaacagactcgaattgcacgtcaacaacgatga
aaaccaaggtgagggcactagcacaacctcaaggaacacaagggcttcagctctagcggaatctgttcgtgcgatgaatgaggtacgaaatatcgtggtt
cttttgaaatcgggcgagtctaactacggtataatgctggcacaggtaattcgggctgagcttgtgccgtatctgatcaaatgcttccatcgcctgttcc
cagtgccatcaaatgcacccaatgctgccaacgccgtgactaaggaaattgaagagttcgataagatcatgcgggaagctggtttgttgttttccccgct
tcccggtgacatcgaaacaaagcaagagacggaaggtgcatcccaagtatccaatttaccagaaacgacagtgctgggtggcgattcaagcgttgccacg
atggaataaatctgaagtttaacctgatcaagcactgcttgtagcatgttcttgcggaggtgcaaagaaaacaggttgttcgtgttggttcgcgtggaaa
caccgtcaagttagttctactctgctctatacgttgcgtcagatcaagggaacgtgatccgcattccatcgtaggtcatttcgatgtccagacccttctc
cttgctcattttcggcagctcaacgctgtgcttggggtagtcgaaatcatggctcatgccagtcagcagcgtgcgtttgggtttgaaagtggaaatctcc
tccatcaccttcttcaaattcatgtgcgtgctgtggtacttgtcgatatacagcgcatcgatcagcagaacatcaatcacaggtttgctcgtatcgttca
agaacgccctcgtctcgtccggaatttcactcacatccgagatgtagacgaaccttttcccgacttcacccccaaattcaaacccgaacgatatgtatcc
agctccgtgaaccacagggaaggggagaaacttgataccacaagcctcgaacggttcccacgggtcaaacttgtcgatttgaagcttggcagtccatcgg
aatggtttcgggactccttcccctgctggaggaaggggttcattgtcgatcaaatacgggaacttggcgattacaccctgactggtaggctcactgcagt
gcaccttcatggcctccggtgggatcttgtacagctccttggtcactggatccacagtctccacagtcgcctgcacctcccgcaggtcgtccatgcccag
cattgcatccgcgtggtcgtgcgtcagcactagtgagtgaacagccgacacgccgatcttggggaagattcgaagtgctgcctcacggaaggtcttgccg
cagtcgatgaggacgttcgtgttctctttgagattccgcacgagcagacttggattgagtcgacgattcttggactccggattcgcgtgcgcttcgtggc
atacagcgcactccttgctcaacacgcagcgcatggacggcaccgacgatgaggggccgcaaccgagcacaaccacttccattgttgtagatatcgacgg
ttggatggataatgagtcgagaaagacaattgaagggttcagtacataaaactcaggaactgctgaatggaatttgatccttagcagacacgcccgcacg
gggtcgttggcattgactcattggcttgcaagttgcaagtcatcaaccacgagattccatgtccagtgtagacgatcagcaatttctgttgagcttgctt
tgcccgactcagattggacacgaactgcatttgacacgcatcgatccttgccagcagcaattcaattcctggctacagtgcctgatatcaatgacattga
gtagctgctacgcttgccttcagccttacgcttcactaggtgcaatacatgtattaactcttgaggatcacgcacgtgcatatggtgttgcagttcgtaa
gattcttcctcgactgcactagactctacggttcgactagcgctttgcaggcaacttggctcttgcccatgccacctcaatcttcgatgctgcatcactg
caggctgctcaaattgtcgtgcaaatcaccgccacgtgcagtcgggttgttgtcctcatgccacgtggagttgccctcagctaagtacgatctagttcct
gcgtcacagtatgtggcaaccacaccaccatcgcatatacggcaaccaacattcattaactgtctttgaatactgcagtaatggcaccacacgagcattc
tcgatctcttcgtagctagtaacttcccctacatgtactgtagcagttgagcttgtacatcgcatatcttcgcacttagtcgagtatcgccgacgcgtgg
caatcgttgacttgttttctgtatgtcccatacaaacacccagtggcttctaagcgggtttctggaagacccattttctagaaacccggtctgagccacg
tcagcagtgcattagacttgaacgaactatactgccttgtattgaaagcgaaacacgaaccctccgatctttttgacttccacgcgttgcacccccagtc
attatcgtttttagctaacgagaagcaaagcagagagatgaacctgacgaagattatcctcatggcggcggctgcctttgccggcgctgtggtggctgac
gacacgaaaggcccccgtggccccgtgatcggcattgacctgggcacgacctactcgtgcgtgggcatctacaaggaccagaaggtggagatcatcgcca
acgaccagggaaaccgtattacgccgtcgtacgtcgcctgggactcgaacgacgagcgtctgattggtgacggtgccaagaaccaggccacgatcaaccc
ggagaagacgttgttcgatgtcaagcgtctcattggccgcaagtacaatgacaagtcggtgcaggctgacaagaagctgctgccgtacgaaatcgtcaac
aaagaaggcaagccgttcattgaggtggaggttaagggcgagaagcgccagttcgcccccgaggaggtgtcggctatggtgctgaccaagatgaagcaga
tctcggagggctacattggccgcgaggtgttcgacgccgtcgtcacggtgcctgcctacttcaacgacgctcagcgtcaggctaccaaggatgccggtac
cattgccggtctcactgtgcagcgtattattaacgaacctacggctgctgccattgcttacggtattgacaagaaggcgcagggcgagaagaacgtgctg
gtcttcgacctgggtggcggtaccttcgatgtgacgctgcttgccattgatggcggcgtgttcgaggtcctggccactaacggtgacactcacttgggtg
gtgaggactttgaccagcgtatcatgcagtacttcatcaagaagtggaagaaggacaagaaccttgacgtcgcgtcggacaagcgtgctctgcagaagct
ccgtcgtgaagctgagcgtgtcaagcgtgccctgtcggcccaggctcaggctcgtcttgagattgagtctcttctggatggtgaggacttcacggagtct
ttgagccgtgcccgtttcgagaagcttaacgaggacctgttcaagaagaccctcggccctgtcgagaaggtgatgaaggatgccgaccttaagaagtcgg
aggtggacgagattgtgctggtgggcggttctacccgtatccccaaggtgcagcagctgatcaaggactacttcaacggcaaggagccctcgcgtggtgt
gaaccctgatgaggccgtcgcgtacggtgctgccgtgcagggcggtatccttggtggcgagcaggacgacctaaccaaggacgtgcttctgatcgatgtg
gttcctctgtcccagggtattgagactgtgggtggcgtcatgaccaagctgatcaaccgtaacactgttatcccgaccaagaagtcgcagactttctcca
cgtaccaggacaaccagcccgctgtgctgatccaggtgttcgagggtgagcgtgccatgaccaaggacaaccgtcttctgggcaagttcgagctgactgg
cctgcctcccgccccgcgtggtgtgccccagattgaagtgacgttcgagatcgatgccaatggtatcctgcaggtgtccgccgaggacaagggcacgggc
aaggctgagacgatcacgatcactgccgagaagggccgtctgtcccaggaggagattgaccgcatggtacaggaggctgctgagttcgctgacgaggaca
agaaggtcaaggaccgcatcgatggccgtaacgctcttgagggctacctgtacagcctgaagaacaacgtcgaagagaagcttgaggacaagatcgacga
ggatgacaaggacacggtccttactgccgtgcaggatgccatggactggcttgaggacaaccaggaggcggacaaggaggacttcgaggccaagcagaag
gaggtcgagaagcttgtcaacccgatcatgtccaaggtctaccagggcggcgctggcccggagggtgaggacgactacgatgacgacgatgaagatgacg
agcacgacgagctgtagatgaacaagcttgaaccgcgttagcatttggaagctttgttgtctccgttatttcttaagtacaaaggtgactattcttttag
tgtattcttgttcaacaagccaatcgaattcatgcacatggtggaattgtcctgaataaaccaggataaccacttttcgcctggatatccattaacgtga
catatccaacattattaggctatgttggctaaatagcttaggatagtgagaggttatgatggcaaaggcaacatacgggctgtacgttttatcaggaaac
cattttttgtgaccattgcatatgattgtaaggtaacaaaaagaacaaacgtaaacttgtttccattgattgcaaacaaaaaatagcactacaatgtgct
ataaccacacgtaggctacatgctcatagctttccttcctgacctcttccttcccaggttaaacgaagccactgtttttgacaaaaatcaagaagtatgg
aactaggccgacaaggtcgtaggtagtagttagctcttgttaagtggcgacagtgtacatcagtgatgaagaagaaaagaagaagtaacgagctgtgtca
gcaatactgagtacaaataagtctgcactggttcgaggatgtgccacatcttcgaggggaaaaacaagacacgtttttactctttttttgcaatatctta
gatgttttcagtgattttagtttgatttaaagcttaaacgtaccaaaactatgtttagcatcgaatacagcaactcacggtcaaatagcatgcctagaag
aacagttatggcattgacctcaacacatatcgcagttatcttaggaatagactgtacaatttttatcactttcaactgctacataatacctaaccctgtg
catatgtctttttttcgtttagcattttctcttcatttcactattagacgcaattgacagtccatcaatacaattaccaagtttgattttctcttatgta
ggacctccaacataacatagatgatgcgccgaaattgatcaaagctatacacctcttatgttgtacggtacaacatatgggaactaaggggttaagtaca
aaggtgactattcttttagtgtattcttgttcaacaagccaatcgaattcatgcacatggtggaattgtcctgaataaaccaggatattaataacctctt
ttcgcctggatatccatttctatcctggattcatccagttttcgccataatgggcagatttaaggagctgacacgagtgctttaggcgaacatttagctg
gcagtggaccggcaactgcccgtgactccccgcacggattgattgtatgttcttgtttcggagcgtactccggcctaacctacgggcatgcctcaaagga
aatatagtt