Description :
From Genome Similarity Track
Location :
Scaffold_160:10201- 23427
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_160-snap-gene-0.22TRNA wybutosine-synthesizing protein
Pytul_var.sporangiiferummaker-pug3_contig_160-snap-gene-0.14Anaphase-promoting complex subunit
Pytul_var.sporangiiferummaker-pug3_contig_160-snap-gene-0.15Anaphase-promoting complex subunit
Pytul_var.sporangiiferummaker-pug3_contig_160-snap-gene-0.24Poly(A) polymerase

Sequence
13226 bases(100 bases per row)
TCAAATCTGATTACAGATCCTTTGCCTAATCGATTATTGCTGGTCAAGGGGTACGCAACGGATGTCGGCGACGAGATGATGCACTTTCGGTGCGTACGAC
TTGACTTTCTCCACGTGCTCGCACGTGATGGTCCATTTCTTGCCGTGTTGCTGCGCCAGGTCGCGCAGTGCAGCCAGCAGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGTTATCGTGCACGTGGAACCAGCCGCCAGAAGGCTTGAGCACCTGCACGGCCAGTGGNNNNNNNNNNNNNNNNNNNNNNCGTC
GGCAAGAGCCCCAGGTTGACACGGTCCGCGACATTCGCGAGCTTCGGTGCAGTCTCTCGGTTGTCGCCCAGGTACACTTGGCACTTGTGCGCGACGTTGT
TGCGCTCCAAGTTGAAGCGAAGCGCGTTCNNNNNNNNNNCGAGTCCGGGTTCCATTCGCACGCGTGCACAAACGACGCCCCGCCATGGACAAGGAAAGGA
AGAACGTAGTACCCGATGCCACAGAATAAATCCACAATCACTTCGTCCCGACACCCGATGGTCGCCATGCGCGCTTTCTCGGTCACGTTGCCCGATGAGA
ACATTACACGTGTGATGTCCCAGCCGTAGATGATGCCGTTTTCACGCACTTCGACCCATCCAGGCGCTTCATTNNNNNNNNNNNNNNNNNNNNNNNNNTT
TTGACGACGTCAACGCCGAGTGATTCACGTACAACAGATCGACGTGGCTCTGACGTTTCTCACTCGGATCGATGAACGCCTTCCGCGCTACGCGTGAAAA
TGCTGGTGAGGTCGACGCACACACTTTCGCCCACATATCCTGTGCAAAACTCTTCCACTCGTCTTCGACGAACGTCTCGCGAGGCACCATCAAGACGTCG
CCGACAAACTCGTACTTGTCCGGCACAGTCACTTGAATCGACGCTGGGACGTGGTGCTTCGCCGCAAACGCAAGGATCGTGCTCTGGATGACTTCGTTCC
GGTTCAGACCGCTGCTCTTCCCAAATTTGTTGGCATACGCGTCTTCGTCCACGACAATGTCAAGCGAGCTAAGTGCCAGGTTCGAAGTCACTGCATTGTG
GATAGAGGCAGTGACTGGGATGAGGAATACCGAGCCATCATCACGCTGAACCACATGCACGCGGCGAGACTTGTCGTACACCTTCGCAACTTCCAACAAT
GTTTTGACCTTCTTTACGTCTAATTTCGCGGCGAGAACGCCAAGTGGACGGCTGCTATCAGTCGATTGCATTGCCTGAAACGAAGCTTCAGTAGAGCGTC
CACTCTTGTTCTCACTACTGCTTACGGCTGCTGATGCGATTGAAGTCACCTTGACAACGCCAGAAATGGACGCTTTGATCAGTGAAAGCTCGCACTGGAA
CGGCGACGAATAGAACTGCCCAAATCCAAAGCACTGGAAACCACCACCCAAAACGTATACGCTGCTGTTGTGGGGCATCCAGGTGCACGTGTGGTACGCG
AACGCAGCATTCGCGTGCTTCACTTCGCCCAGTCGCATCCATTTCATCGTCTTCGCATCCAGCAAAAACAGCTTTTGTGTCGCATTGTCACCATTTACGA
GCGACGACGACGTCATCCCACCAGAAAGCACGACGTGGTGGTCGCTGACTTCGCACACGCTGCCGGCGATCAGACTCGCCTCGGGCCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGGTTTCCGAGCTCTTTGCGTTCCCAGATCCCAGTCACGGTATCGAACAGTAGACAGTAAGTTTGCTCCTTTTCACTTGCTTCCA
GCACGTTGTCCACACTTTTCTGGGTGACTTCACTTGCGTCGCTGCCATCGTCTTCGACACCCCGAGACGACGTCATGCCTCCCCAGAACAACACCTTTGT
CTTCTCCACCACAGCGCTTACGTGATCGAATCGAGGATACGTGAACGGGTTATCTGAATGCCAAAACACAAGTATAGTTAGTCACTTTGCTATCACCAAA
GGAAAACACTTCAAGATACAGTCTTCGCACCAATTTGTCGCCATTCTGGAGTGCTTTGACCCAAGTCGAGAGCAAAGAGATCGCCAAGCACCGTCGTGGC
GTCCCGACCACCATATACGTACATGGTTGAGCCAACTACATAATTAGAGCACACAGAACTGGGATTAGTAAATCCTATCATGCTGTTTGGATGCACGGAA
TGGACGCGCACGTACCGACAGAGCAGGAGTGCTTGTATCGTGGGGAAGGACCGCCGCCAATAGTGCCAACCGCTCTCCAGGTGCGTGTGTCGAGGTTAAA
CGCGTGAACATCGTTAAACGGCTTGGTTGGACCCGCACGACCGCCAAACACGATCATTTCATTGTTCACAACCACAGCCGAGTGCTGCATTCGCGCAGAT
GGACCTGCATCAGCTGACTTTTCCTCCTCTTTGTAGATCACCTCGAGAGAATGGTTCTTTGCCGTGCTCACAATCGTCAGCGCCGCCAGTCGAGAAGTCG
TGCCCGAAGCCGTCGCTCCCTGACCGCCGAACACGACGATGCTAGTGCCGTGGGCCACACTCGTATGGCCGACGCGCTTGATCTCATCGCACTTGAGCTC
CTTGTACAGATCGAACTCCACCGACGAGACTGCGGCCTCATTACTTGCAGCAGGCTTTTCACCATAAAATTTGGCCTTAAACGCTTCAAACAACTGGTCG
GTCTTCTTTTTGTTCGCAATGAACTTTTCGTTCGCGATATCCACAATCCATTTCAGATACTCGTCGCTCACGAGGAGATCCTTGGCTGAGTGCGCAATCG
GGATCTCGAGCCCATTCGCACTCGTTCGAATGGCGCACATGATCTTCTTGTTCCCAAGCACGACGCCCGACTCGCGGAAGCCGCATGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCCCATTGCAAGAGTTCCTTGGCAGCATCCAGGTCACGGCACACAACGTGCATAATGAACGGCTCGTGCTTGAAAATTAA
CTGCAGCAGACACACACACAACCAAGCGAAAACAATCAGCATCCACGTACGATGAATGATTCCAATAGGTTATTTACACTTGACAGAAACGACAAGAAGC
TACGTACCATGTTGCTGTTGGCAGAAGTCGCATCTGGGGAACGTAGAGCTTGCGACAGTTGCTCCCACGTGATGGTCGCGTGCTCCGCCAGGAGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCGTCGCGCTCTCCTTCAGCACCCGCTTCGCCAGCAGTAGCAGTCGCCGGCACGCC
ACAAAACACCGCAATGCGTCCCGAGCATGAACTGCTAGTTACCTGCATCACATACATGCACACATGTCAGCAACTAATATAATTAGGAGCGTTGTTGCCT
TTTGCACACTTCCGCAACTACAAAAGACGCTAGCGCACAGCAGACACAGTGAGCAATACGCACGTAATTTGGGTGGTCGTTGATCAGGCGAATCATGTCC
ACGATGGGCTCATCGATGCTGCCCTTCGGGCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTTCCGCAGGCTCTCACGCTTGAG
CTGCGCAAACATGGTAGCGCAATGTCGTCTCCACCAAACAAACCAAACGGCTCAGGTTAAACCACGCGACCAACACTCCGCACGTCTCTCTCTGTGACGT
GCTACACAAATACTACCCTGGAGGTACTATTTATGCATTCAATGTAATTTTGAAACTAGGACCTGGCCTAGTTTCGTGTACGCTTTGAAGAAGAGGGTCC
AATAATAAAAAGGAAACACAACCAATTTCGCAATTTGCCGCCATAAAGATACCCGCATGCCAATATGGCGATGAGCTATGCAGCTGGCGATGTCACGTCT
CTGGGCGTCGACACGAGCGCGTATATTGGTGGCCGCTCAAATGAAGTGATCGGACGAGAAGGAAACGCAGTTGCGGATCTGCCGCGCGTGCGCGTGCGCT
GGACGAGCGTACGGCGAATGGAAGCGGGCGATCCGTTCGCGCAAAAACTGGCGGCAACGACGCTCGCGGGCCATATCAACAGCGCCATNNNNNNNNNNNN
NNNNNNNNNAGGCGCCACGCCCACACACAACAATAGAGGCAGCAGCAATGCGAATACAGCATCTTTGTTGCCATATACGATGACGAACAAGCTGTTCTTC
ATAGAGAGGGAGTATTGCGACACCCCGTACGTCGTGCGCGTGACCAACAATTGCGTCGCGTTTCTCCATCGAGGCACGCACCTCGTCGAGCGCAGCTTCG
TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGATTGACGCGGTGATGGCATATTTCGACCCCATTGCTACACAAACAGCAGTGTTGAACTCTGGTAGTG
GAGAAGTCACTACTGGTTCATTCGAGGAAGCTCACGCTCGACATCCAATCGATGCCGACTCAACGGCGTTTCTTTCGCGCAAGAAGCGAGGGCGTCGAAA
TGGTTTGTATATTCGGCCAGCACCGCATTTGTGCGTACTGGTGCGGTCGGACTGCGTCAACATCTACACACCAAGCGGCGACGTGTTCGAGGCAGCGCTC
CCATTCCAAGCTAATCGTCTCTTCGCAATGGGCTCCGGATTGCTCATGCAGAGAAGTCCCGCTACACAGCCGTCAGTCTACAACAAGAAGACTGATACGC
CCAATTCGACTCTGTATGTGGACAAGGAGTTCTCAACACGTCCGCGATTCTTCACGTTAGCGCATCCACTGGATGAGATCAAGCCTGTGGCGCTCGCTAC
GGCATTATCGGACGAACGTGCAAGGAAGACGACACGGTGTTCGCAGAAGCCATCGCGAGCACCAGCTTTTCTATGTGATCCTGCGCTCGAGATCGTGGCA
TTTAATGCGATGCACTCGCTGCTTGTGTGCTACCACCAACGAGATCGTCGCTTTTGTGTCTACAGGCTGAAGCCTTTCCCATCGAGGCGTTCCGAGCGCG
TTGTTCCCATCCAAGTCGTCGATTCGCTAACGTGGCAAAAGCATCGAGAAAAGGAGCTCGATAGCCACGACGAGCAAGTGGCCATGATAGATCCAGATTG
GGTGGCCGAGGCAGCGTGGGTAGCACCTCCNNNNNNNNNNNNNNNNNNNNNNNGCGCGCCTTAGCGGTGAACTTGACGTCTTCAGCTGTGTCGTCGTCTT
TGCGATCTGCTTTCCTCGCTTCCGATCTAGACCGTGCGCCTCTTTTGTGCTTAATGGACAAAACGACTGGCGTCCTCATGCTGAAGCGAATCGACGTTCT
TACACGAGACACCAAAGCAACAAAACTTGAAGACGTGCGGCTATTCCGTTGCCGTGATGCTTTGCCAATTTCGACAGACCCAGAGCAGCGTTCCAGTAGT
TTCAGCTGCGTGTCCAAGCTATCTGCAGATAATCTAATCGACATTGTGGTCATGACCAAAGAGGGAAAGCTGCAATTGCACCGAGGCATTCATCCCATCT
GTGAGCTTGCACAGCCCAGCACCGGACCAGATACAAGCACTCGAAGCTCTTGGCCACTATCGACTCAAATCAGGATGAAGGACGATGCGTCGTGCTTCGA
GATTTGTGGGCACGATTTGATCAACTATCCAGAGATGCTGCACCGATCTGGCCATCCACTTCGTGTGTTGCATTCTCCGCTTTTGGAAAAAGTGTTTGCA
GTGCTTGAGATGGTGCTTCCTCCGAGGGTCGTGCTTACATTACGTGCCGACGTGATTGCTTACCTTCAGCAGCAAGTTGATGCAGGAGAAAATCCTGTGC
GACTCTCTGAAGCAGATCAATCCAGTGAAGATGAATGGACAGCTTTTCAAGGTTATATCATTTCAATTCTTGACGACGAGACCACTTCTCATCATCAGAG
TAATGGCAGCAGTGAGGTCAATGGTGACGAGTTGCAAGCCCCTGCAATGACCGCATTTGACAAGCTTTGCCAATCAAGTTTCCATCAAATGTACCAACTT
GAAAACCCAATGCTGTTCTTGCACGTAGACGCCCATTTGGGCCAGCAGGAGATGTCACCGACAAAGTCTATTATGCCATGCAAGACGATTCTCCGGTCTT
CGCCAAGCAAAGCGCTGATACAATCACATGCGATGCAGATATTTGCTGCGCTGCATCTGCTGTATGAAGATCTCAAGTTGTCGGTGACATCATCTCAAAT
GTGCCTTCAGTTATCAGCATTGATGCTCGACATGTCGTTTGGACTTGACTTGCAGGCGTACAGCGTATACTATCAGCAAGAAAGCTGCGTCTCCCTGTGC
AACAAAACACGGCTACCGTCAGGGCGTACCAAGAAGCGAGAAATGGAATCAACCTTGTTTGCAGAATGCGATAATAGTCATGTCCCAGAGATTACCCGAT
GGATTCACGCGAAAGTTCAGATATCTAGCGGTCAGACGGCATCCGAAGAAGATCCATTTCCGACATTTGCAAGCATAATGGCTCCGAGCAGCCGAGAACA
AGTGTATCAAGAACAGAAAGAGACACCTCTTTGGCGAACGGCAGCCATATGTCATATTTATGAGCTGCTGTTCCCAATGCAATCACAGCTACCAGAGGCC
ACACAAAATCGCGAGCATCACCAAGACGAAAATATTGCAAGCTTGATGGTGTACTTGACTCGAGAGAGTTTTGGGATACGGTTAAACCTCCAAGATCTGC
CGTTTGCCATTCAGTTCCCCATCGCTGAGACGATCAGCAAATTCAGACATTCGCCACCACCATTTGTTACTGAAGACGTTTGCAAGTTCATCGGTCGAGA
GGATCTCGCAGGAGATGTTGCGAACCGGATCAATCTGCACTTTTCTGATGTTGCCCATACTCGCTATGACAGTCAACTTCCTAAAGAATCGGTAGGCGCG
CAGTATCCGAGCGACGACAAACCTCACGAAGTCAGTGATGGACTTGAAGAAGTTATGGCGTTCAGCCAGCAATTGTTCCCGCTCGATCAAAGAATGAAAG
AAGTTGCACGATTGGTCCGCTCAAGTCGCCCCCTCTGTTTGAAACTCGAAAAAACGGCGGATGTGTCAGACCAAGACTATGTTCTGCAGCAGCAAGCACG
GCTGCTACTGTTGTGCAAACGGTCGATGTCGCTTCCGGTCGCGCGGGGGATGATCACATTGGGCAGCTTTGACGTGAACACGACTCAGAATCATGCCTGG
CAACTTCGCGTTCCTGATCTCCCGCTTGCAGGGCGGACGCCACCAACGAACGCAATCGTGTCGTTGGATATTAGTGGATATGCGAAGGAATTGACATTTT
GGCCACAATTCCATAATGGATGTGCAGCTGGACTGAGACTTCCAGCACGTGATTTGTCCAGTGTGGTCAATCGATATTGGATCAAGTATCATCGTCCGTC
GGTTGCTAACCATCAAGCGAGAATTGCACAGCGAAGTAATGGTCAAACAACTCAGTCTCCTGATGCCTCAAAACTTACTCTGGAAGAAAGTTATGCTGCC
CATGCTGGCTTATTGCTGGGCCTCGGATTGCGTGGCCATTTAAAATGCCTCTCGATGGCCGACGTCTACAACTATCTGTCGCTTTCAAACGAATTTGTCA
CTGTTGCGATCCTCCTGGGCATGGCTACGACCGCAGCTCACTGTAGGCAGCGTCGAAAACGTCTATCAGAAGCAACCGTGCATGGAAATTCAAGAAACGG
AAGCAATGCTTTGGGATCGTCACCAGCAACTCCGTCCACAGACGCTGGTGCAGATGCTGGATTGGCAGACGTCACGTTGGAAGATGACACATCCATGTCG
GAATCTTCGAAAAATGCATCGAAAGCCCCCCTTGTTGGGTCAGGCCTTGAGCTCACACTAGAGCGATCTGTCTCAAAAATGCTTTGTCTACACATTCCTT
CGCTGCTGCCTCCGCCATTTGCCGAGTTCTCAGTTCCCGCGTCAACACAAACAGCTGCTCTGCTTGGTCTCGGAGTATTGTATCAAGCAACAGGGCATCG
TCTAATGACAGAGCTGCTTCTCACTGAAATTGCTCGTTCACCTTCGTCCGCTCAATTTGTAAGCAGTACTACCAACTCAGGATTGTCAACGGCTTCGTTT
GACCAGCTGGAAGGGTATGCTCTCGCTGCTGGCCTGGCGCTTGGACTGGTCGTCCTCGGACGTGGGCAATCGAAGAGTGGGGATCCGGGTCTTGCAGATA
TGAAGCTCGAAGAAAAACTCTACAAGTACATTGTCGGCGGTGCTCAGCAATTTAGTGATGCGAGTGCACCTGGCGGATGCTTGTACCGTGGACGCAAGTG
GGATACCTTTGGACAAAGTGGGAGTATGTTTGACTCGAGAAGCGACTCAAGTGGATCCACAGAAACCCCTTCGGTGGCAGGACGCGAACCGAAAATATTT
CAAGATCACAGCTCACGAAGAGAGCATGTTAACGTTGGCGTGACAGCGTGTGGAAGTGCATTAGCGTTAGCGTTTATGTACATGCAAACGGAGAACAAAT
CCATTGCAGCGCAGCTGAGGGTCCCAGATACGTTGATCCTGTTGGATAATGTTCGCCCCGATATTCTGATGGTTCGTACTCTGGCCAAGAATTTAGTCCT
GTGGGACTCGGTGACACCAAGTGTCGAGTGGATTGAGGACGTCGAAGTGCCGGTGCAGCTCAAGAACGCGTATAAGGCACTGCAAGCTGCTTCTGCAGTG
GATAAAGACGTGAAAGAATCACCAACCAATGCAGATGCACAATCAGTTTGTGAAGCGTACGCGAATATCGTTGCTGGTGCGTGTTTCAGCATTGGTCTCC
GTTTCGCAGGCACCACTGATACCCAAGCCCGCAAGACGCTACAGAAGTACATCTTACACTTTCGGGATATGCGTTCAAAACCTGCGTCGACGCGAGTGGG
TAGTAACAACACAATCATTGCTGCGACGGAACGGGTGACAATTGAGCGATGCCTTGCTGCGTGCGCACAAGCGCTTGCTTTGGTTGATGCAGGATCCGGA
AATGTAGAGACGTTGACACTTCTTCGATCGATCAACCTACGGCAGCGCGTCGATTCAGAGCTAACGTACGGGAACCACATGGCATTGAGTATGGCGATCG
GCTTGCTTTTCATCGGCGGTGGCCGCGCAACGGTATCACGATCCAAAGAAGCGATTGCATCGTTAGTGATCTCCCTCTTCCCCATGTTTCCGATGAACAC
AGTGGACAATAAATACCACCTTCAGGCATTCCGTCACCTCTATGTGCTCGCAGTGGACACGTCCAGATTACTCGAGACGATCGATGTGAATTCCGGATCC
AGTTGTTCTGTGCAAGTGCGTGTGCAGCTTCGTGGACAGGTGAATCGCAGTCACACTGAAACAGCACAGTCGTGGCTGACTTTGCAGTCGCCGTGCTTGC
TGCCTGATCTAAGCTCGATCAAGCGTATCATTGTGTCGGGAGAGCAATTCTACCCTGTGGAGATTGTGATGTCTGCCAAGAAGCCGAAAGGTTCTTCTTC
TTCTGGTAAACAGATGCATCATGCTACGACAGCGAATGCACTTCGACTGGAACTTCTTCAAGAGAAGAACATGATATTACTGAAGCGAAGAAAACGGAGT
GGGCCATGTGTCGGTGGCCTCGCAGATATCTCGAATACACTGCGCGACTTGCATTACGCTAGTAGCAAGCATTCTGCAAATGACAAGGACGACCACTTGA
TGCTTGCCTTCAGATCGTATTTCTTGTCCAAGACAGATCAATATCGACTGAACGAAGATACGAGTTCTTTTGGAAGCTGGTGGACTGCCCAAAGTCAACA
GCTCGTCGCACATCACATGCATGAGGATGTGGCAAGTCTACTGTCGTTGTATCTAAACACGTTACATGCTCTCTTCCAATTGCAGCACGCACCATCTTTC
CAGTCAAGCACGGGACTTCGCAATCTGAAACTGTACATCGACTTTTGCGAGGCGACACGACAACGACAGCTTGACCGCAACGAACAGGACGAGGTGAAGC
CATTCTCATCGCGAGACCAGGGTGAAGATTTTGTTGTCTGGCTCAAGCACCAAACCGAGGTCGCTCTTCGAGATTTGTGGCGAAATGCATCTACTGCAAT
CACGTCTTCCGCGTCTGCGCAAGCGCGGGTTCTTGATACAGCAAATGTACCGAGTACTGTTCAAGACGCATTTCTCATGAACTCAATCGCAAGGTATTTC
GCAGCTCCGTCAACGAGCGTCTTGAAGACTCCAGACGAGTGGCAAACAAAATTCCAGCGGCTCTTATCAGCAACTTTGTCGTCACCTACCGATGCATCGA
ACCAATTCCAATTGCGCAACTTCCTCGACATCCAGCAAGACCACGTGACGGAGCAAGAGAAAACGTTTTGGCTGCAATTGGTCTCATTCTTTTTATTTGC
GAGCTGATTACGACTAGGTAAGTTTTTTTCTTATCGATTCGATGTGTGAAATCCAAGAGTTGGTCTGGAAACATGCAAATATAAGGGATCATCGTCGATT
TTTCTTGTTTGTTTGTGTGCTCTAGTGAGATTTCGATCTTCTTGACTCTGGCTTTTGTTTTTCTTGTCCCAAATATGTTATTATGCTTTGATTTTTTTTC
TCTCATGAAGCCGCTAATGGACGCTTCGCCATTGCTCCAATTCTCTTTTACTAAATATTTTTTGTGTGTGTTTGCTTTTCGTTCTCTGGGCTACTCCTCC
TGTTGTTCCTGCCTCTCGTATTCTTTTTCATCTTTTTTTTGCTTTGCATGCTTTTCCATTTGCCCACGCCTTTGCTTTTTTCTCTTTTTTTTCATGGGCT
CATTTTTTTTTTCTTTTGGAAAAGCTATGTCAGAGGAACAACTCAATTCAGTTTTGAAAACGTGATTTTCATTTTACGTCTCTTTCGAGGAGAAGAGATG
GGCGCCGGTGGTGCGAGCACCTTCTGGGTCGGCAGCGCTGATGGCAGCGGAGGCTGGATCTTCGCGGTCTGCGCTGTTGGCACCGAAGATGGCGTTCCAG
AGCCGACACCATTCGTCGACACTTTCCCCGTTGGAGTCCCCGTCACTGACGACATGCCGTTGCGATCACGCTTACCTTGAAGCTGCGGCGACGTGCCAAC
CACCACCTCTTTCTTCGTCTTGACAGGAGTCGACAGTTCTGCTGGTTCAGCTGGACCAGATGACGACTCGGCACCATCGACGGCCGGATTGGGGCTTGCT
GGCTTCGAGTCAGGCTTTCCGGCGCTGGATTCATCGACCGAGGCNNNNNNNNNNNNNNNNNNNNNNNNTCTTCGGTCGCAGACGCATCACCATCCTCCAC
AGTGCCATCGGTGTCTTGAGACTGCGTGTCCTTGATCGCATCATCTCCAGATGATGTGCCATTCGCGGAAGCATTGCCGGCAGATTCGGCTTCTTTTGCT
TCCTCTTTCTTCTTCTTCATAAACTCACGACGGATATTGCGAGCAACCTGGCGGTCACCCATGTCTTCAAACACACACTCGGGAAGGTTCTTCCACACGA
CAGGAGTAATCTTCACATCCATCGTCGGTGTTCGCTTGTTCCAGCGATAGAGATCATTGTGCTTGAAGTAATCCACAGAGCTATCGATAGTGACTTCACG
CCCGCGCAATTGACGGCGATCGATATCGAAGCCAACAAAGAAGCAGACACCGAACTTGGTTGGTTTCGCGGGAGCAGCGCTTGGATCCTGTCCTTCTCTG
ATCGCGTTTGACGATTGCGTTTCCACGAAGCTCAGTGGATATTTCTTCGTGAACGTGCGAATCCGGCACAGTTGCGGAATATACGCGAGGCTCTCCACCA
GCTTACGAATACGCGACTCGCAAAAACCGCACCACGCTTGCTCTTCGTCCTCGACTTCCGTGTACACATCCACTGCCAGGTAGTGTTGATGCACGGCAAA
AAAATCCGAGGGTTCAAAAAGCGGAGCCCAATCCACGCCTCCTTTATTTAAAATATCTTGCACTAGGTCAAGCGCGCGTTTAAACTCCTCCTTCATCACC
GCCAGCGTGTGCGAGGACACGTTGAAGGACGAGTTCATTGACGGGTACGCTGGAGTCAAGATCGGCATCGTCTGGTATCTGCACGCATAGCAATTAAAAA
GTCAGTTCACAAATGCGCATTCTCCAATGTACGACAGACGAGAAGACCGTGCCTGTTGTTTCCAGAGTTCGCATTCCAGACTTCAAGCCCGAGCTTCGCG
TCGTGCGTCTTACAAAGCTAAGCATCATTCAAATACAACCAACAAGTTAGCAACCAATGACACCAACATAAAGCAGTAATGCAATGTACCTGGATCGCAA
GCGGCCATTTCCAGTTCGCAAGCACCATGAAGAAACGCAACAGCAGTGTCGATGGCGCTGCCGTGGGGTATAGCTGGTTGATGAAGCACACCAAGATGCA
CCAGTTGACACCACCCAAGTACCCCATCTTGTTCGAGTACAACCCGCGACGCTTCGCCCAACGACGCACAATTCGAAGCACACTGATAAAACTGTCACGA
TTCGGCGTCAACTAAGATGAGAGGATAAAACAAACCATATCGTAGTGTGTCAGCCAAAAGATCGCCAACATAAAGTGACAGGTATAAACAGCCAAATCGC
GTACGTACCTTGATCATGAGCTCGGTCACGCGTGGTCCATTGAGAGACTTTTCCGTCGCGGTATCCACACCGACGAGGACGCTATCATCCAAGATGTTGA
GGTTGTCCGGGATGGTGTTGCGCGGGAGGATCGCGATCTGTAGATCGATGTTGATCTCTTCGTAATCGAACGTGATGATCGGCACAATTGCTCCTTCAAT
CGACACGAGGTTCGACACTTTTGGGTGCTTCAAAAAAATCTCCTTCAGCGACGTGAAAAAGTCTTCGCGCGTGACATGACGCGGCGCGACACAAATCGTA
TCGATATCAGCACCAGGCTCATTCACGCCAAGACGATACGATCCGGACACCAAGATCTGGCCACCAGCGTCCGCAGCGATCTCTTCGGGGACACCCTTCT
GCAGACACACCTGCTTGACCCAATCGCGGAAGATTGAGCGAAGCTCGGCCAGGATCATCGAGCGGCGCGTGATGTTCTCGTCGCTCTCCGTAGGGAAGAA
CTCGTCCATGTACTTCTGGAGCTTGACCGACTGCTCGAGGTCCTTCGGCTCGGGTGGCGTCGTGCGGATCGCCTTGTATGCCTGCTCCAGCACGTGCGGC
GCGACCGTGAACGTCGCGCTCTGCAT