Description :
From Genome Similarity Track
Location :
Scaffold_475:1020- 7157
Sequence
6137 bases(100 bases per row)
GCGTTCTTCAGTCCAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAAAGCGTTATCAATCAAACGCT
GATAAATCTGTGAAGCGTTCTTCAGTCCAAAAGGCATCTGCAACCATTCAAACAGACCCGAAGGTGTGCTTTTCTCGTTCGGTCGTCTCCACCACCCAAA
ATCCACTAGCCATGTCCAATGAACAATACCACACTGCCTTATCCATATCTTGCAACGATTCGCTAATAAGAGGCATGAGATAAACCATCAACCATGTTAG
CTAATTCACTCGTCGATATTCAATACATAGTCGGATATCTTCCTCATTCATCTTAATAATCACGACTATTGGTGACGCCCACGGTGATGTCGAAGGTCGA
ATAATCTTAGCTGATAACAGGCCTTTTATCAGATCAGCCAATTTGCTCACGAATTTCGGCGCAACTGGTCGGACGCGCTGAGCTATCGGCCTTGCCTCTC
CAACATCAATATCACAAACGTCCCCCGTGCTTCAGGGGGTAATGCATTGCCTTTTCCAATCAACAGGTGACGACTCTTCTATATCAGTTGTCGCAAATCA
TCTTGATCTTCTGATAACAGTACCCCATGATCGCCAACCTGGCCATCGTCTATCCTTATCTCTGTCGTAGATTCCGTCACCTCCGGTAGCACATCCATAT
GCTGCTCCACATCTTTCGGGAACAGTCCACCTCCTTCGTGGTAATATATTGATTCAGCCGGTATATCTTCTTTCATCATTTCCTCGTCAATCGCAGTGGC
TTCCGCGCTGTCGACCAATCGTGTGGACCTGACATGCACTTCTCAATCCTCTACCTTGATCTCATCTGGCTGACAGTTGGACTGTCCTTGTAGCGGATCA
CTTGTCACATGGTCGACATCCTGTGTTATGTCCCTCTTTACAACCCTGTCTACTTCACTCGATCGTTCTAGGGTCTTCCGCACTGCGTTGGCCGCGTACG
ATCTCTTTGAAGATCTACCATCCTTGCCTTCATTAATATTTCCACCCGTATACTCGCCTTGAATCTCATGATTGATGTTACAATCAGGTTTAGATCGCGA
TGTGATCCCCGCAGAAACCATGACGTCTTCTAGTTCCTCCTTTGGTCGAATTAAAAGTCGGGTGGGTTTTTCGTACGTAGGATGATCCACTAGCGGTTCC
GCATATGCTTCAATCTCTTCTTTTTATCGATCTGTAGTAGCTTCAAAGGCCGACGTTTGTCATTCCTTATACCGCCGCTATCCGACAGATCCCTGAGACC
GCGGTGTCATGTCTCTGTAATCCACAACGCTAAGGGGGTCCGTAATTTAAGCTCAAGTCGCGATCGCGTATATTCGTAAGCTGCAAGAACTTAACCATTC
CGGGCCTATTCGTCACGGTCGGAACCCACGCCACATCTCGTCTCACCCAAAGCTTGGACTTGGGAGGATTGACGCAGATCCTGACTTCAGTCGATCTACC
GGCAGGGATGACAATATGTTGATATTTAAGGTTGATCGCCAATATATTAGATCGGTACGGCAGTCTCCGCCCAGCCAAACAGATGCGAACTTTTTCTGGT
AGACACAGGGTTTTGTCGGCCAAATCCAAACGGATGCCTGCCGGAACCATGAAGTCCATACCTAGTATGGCTTCTTGACCAACTTGATCACCAACCCAGA
CATCAAAATAGTATACTAGTGATACGTCCAGTGGGATTTTAATCTTAGTACACCCCACCTTCATATATGCACTCTCCCCGATCCCAACACATTCTTGCGT
TCGGCTCTCGTCGATCACACATCCTACCTTACGAGCAAAGATTGTGTCGATGATCAAGATTTCCGCACCAGAGTTAAACAGCATAGTGGCCTTCTAATTG
TTGATCTTTCCCACTGGTTCGCTTGTTTGAACCAATTTCCGGGGTATGGTATTTCCAGTGTTCCCTTGACTTCCCTGGGGCGACATCGAGCTTCATCTTG
AGCGGGGGTCGAGCACTATCGTCCACTCGTTTCACACTTGATATAGAAGAAACAAATGTAGAACGATCGCATATATTAGTGATCGGATCGCGCCGTTCCT
TAACTCCTTGATCCTCCAATCGTTTTTCAACAAATGCATGTTTGCATAGCCTAAAACGTTGGCTCGTGCCAGATTCCAACCTGGCGAGCGTCCTGGTTTA
ACATCTCCTCGACCTTCGGAGAAAACATCCCAGCATGTTTGGTAGGCACGTACCACTTGCAGATCAAGTTATAGAACTCTTCCATAGGGCACTTCTCATT
CTCATGCATCTCTCCACAAGCTGCAAACACATAAAAACATTTGTCCGATGGATGTTGCTTGCCGCATTTCTGGCACGTCAGTCTCTGCCAGAATCCACTA
TCGTCGTGTCTCTTCAATACACAATGAGTGTAGGCTTTCTTAAACGCAACGCGACCCGGAATATAGCCTTGACAATTCTCGTCGGTTGTAGCCCGTTGAT
CTCCGAACTTCGTCGGCGGTCCGAGGTCGTAGCCACAAACCTATTACGTGGTTCAAGTTCCGCGTCCGATCCGCTAAAGTCGGATTCCAAAGAACTGTCC
GCATCCTCCACGTGAATGGGCCTCATGGCACGCGCTGGTTTAGCCGGTTTTGGAGAAGCTGTGGGTGCAGATTGTGTTTGACTTTATTCGATCCCATGAG
TGATCGAGTTTGTCGATATTCCATGTGCTAGTGAGAGCGTAAGGTACCCTCCATATGATCCACATCACCGATTCGTAACAGCGTCAGTTGCTTGTTCTGA
TCGCGATCATACATGGTCCCAATAAAGTGTTCCACGTGTTCACGACGAATGTCTGGGAATCCATCTCGAATTCTCATCTTTGCTCGATTCGCTGCCACAT
TTAACCGATACAGGTAATCCAGCGGCAGCTCCTCCGGTCGCTTCTTGGCAAGATAATATTGTCTCCCAGCGGACATACCATAACCACCATATTGCACGAG
AAAGTTTTCCACCAGGTCCTTCCACAAATGACAAGTGGATCGGCTCATCTGACTGTGCCAATTTCTCGCCGGACCCGTAAGCAGATCTCCAAATACTAAG
CACTTCTACACATCTGGGGCTTGATCATGTAGAAATGAAAACGCAGACTTAACCTTGCCGATCCAGCTCCTGGATCTATCCTCTTCTTTGTCCTTCCCAT
TGAACTCTTCCAGTTTTGCGATTGCAGACATCCAAATCCGCGGAGCGCTAAGTCCACCATCTAGCACTTTCTCCGCAGTAGCTACAAGTGGTCGTCTCGA
CTCGACTTGCCCTCAGTTGTTGGGATCTCCTGCTCCACGATATTGCATTTTAGCGCCACCGTGATGCGATCCAACCGATTCCATCTCATAACATCAGGGG
TGTAAAACTCGATATCCGTTGCAACCTTGATCATCTGGCTTGGGTAGATTGATTCGCGGGCCTTATTACAGCGTTCCTGCTGAAATCGTTCTATGGCAGC
ATCCAAATATGATTGTAGTTGTCCTTGGGTGGTCGAATCCGCATCTTCTTTAGCGCGTACGGGTGTTGATCGCGGTCCGCTCTCGATCCCTTCCCCACGA
CCAAGTAGATCAGCCTTCGTTTCCATGTATTCGCGCAGATTAGCAGCTCCACTTGGGCCTAAAGACATCCGCTGAATGCCGATTGAGTCTTCTAACTCTA
CTTCAGATTCGGCTGAGGCATACTGGGAAGATTAATTGTGATATCCTCTCTGAACTTCTGCAGCCGTCGGTTCCACGTGATCGTTCGCCGCAGTCGCTTC
CGCGTGATCATCAGATTTACGTATGCCCGTCAAAGGGACTAACTTCTCATACAGCGGATGGCACGGGTGTATCAAGCGATCCTGTTCGCAATCCAACAGC
TCTCTTGCATCGAATGATCCCGCAACGAATACCGCTTCGTTCGGCAGATGTATAATTACATTGATTCCATCCAGTGTATTCGACGCGATCACTGGGGTTG
ATATAGGGCCTTAAATTGTTCCAATAATCCTAGGCTTCAGTATCTGGAGCACTGGATCGTCAAGAACTTCTTGAGCGTCCTCCAGTGATACATCTCTGCT
ATCTGGTCCAGTTGCCAGCCTTCCATCTTCCCTTCATCTTCTACAAACTTGATTGGTCTGATGGCCCGATCCCGTCACGCGATCGGGGTGATCCGATCCT
GGCGCTGTCTTCTTCACTCGTGCAGTCTTCGACTTCGTCTTTGTTGACGTTGCAGGAGTGACCTTGAGTGGACTTTGTTCGGTTTAACCGAAGGGCTTAC
ACCCAGCGAATCATGCATTGCAGCATGATCCACGGTGGTCCTCGAATGGACCTCAGGAGGGGGTTGGTGGTTTCTTCCCAATCGATCGATCGATCTTCCT
CTTTTTTTTGTCATCAAAGCCCCTCCCAAACGTTGTTGATCTGTAGATCCTTCATCTCCACACGTCCGCGACGATCTCTCTTTCGCCGGCGCTTCATTCC
CAGGTTCAGTCTTGATCCTAAAGTCTTCTCCAAGGGACTCAAGGTGAAATCCCGAGTCACCAGAAGATCCGGCCACGCGCACCACTGTGGTGGAGTGGGA
TTCGTTCATTTTATGAGGCGATCCCAACTCTCCACAGGCGCCCAGACGACCGACTAACGGAGGGGGTACTCCTATTCCGCGTGCTTTGCCCTCCTCACCT
TGTGTAACCGTCGGTAGGGCGGGTTGCACTCTTTTAG