Description :
From Genome Similarity Track
Location :
Scaffold_195:1020- 5954
Transcript NameFunction/comments
Hyaar_Emoy2812351ubiquitin-specific protease, putative
Hyaar_Emoy2812352hypothetical protein

Sequence
4934 bases(100 bases per row)
CGACTCGGCGAGCGATGGCCAGCGCCACAAGCGACAAACGACGGGGTCGGACCGCACTATTCAGTCACTAGACGTCACGGTGTCTCCCACGAGTCAAAGT
CCTGCGGTCCAGGCGCCGCTGCTGCCTGCATACTCCACGTCAACATCCACGTCCCCAAGAGCTCTTCTTCCAGCCGCAGTGCCGCCACCAATACTCGTAT
TCAGCGGCAAATTTCAAGTTCTGGAACCTGATAATGAGCAGATCGTGACGCCAGTGAAACGTGACGCTCAAGGCACTTCTTGGCGAGTCATTTGGCAGCC
TCGAAGCCTCACGGACCATTCGTTTGTTGGTGTCTTTGTCGAGCTCGTTACCGACGCGCGAGAGCATCAAAATGTGTTGCCACGACTGGCTGAGGTTGGG
ATCGCGCTCTTGCATCAAAGGGGTCGTGCGTCGGTTGTGAAACACACGAGCGTGCATGCGTTTTCCAAGGACACGCCAATGTTCGGCATGAGTCAGTTTT
GTTTACGCAGTGACTTGCTGAATCCATGCAATCATTTCTTGACGACCGGTGGAAAAGTGGAGATTGAAGTGCAGCTGACGTTTGTCGCGGATACTGCAGA
TGTTGAGATGGAGATTGAGGAAAATGTGCATGCGTCAATGGTATCGTCTCGTCAAGATGGAGCCTGGACAAATGATTCACAGTCGATGCAGGACTTGCAC
TCGTACGACTCGAAAGAGGAGACAGAGATGGTGGGGTTGAAGAATCAGGGAGCCACGTGCTACTTGAACTCGTTGCTGCAGACGCTGTTCCACTTGCGAG
CATTTCGGCAAATGGTGTATGAAACACCCACGGCTCAGGAAGATACCAATAATTCTGTGTCATTGGCACTGCAGCGTGTGTTTCACCGGTTACAGAGTCA
ACAAAAGGTAGTGTCGACGAAAGAACTGACGCGCTCGTTTGGATGGAGTGCAATCGACTCGTTCATGCAGCATGACGTGCAGGAGCTATACCGGATTTTG
TGCGATCGGTTAGAGGAGAAGATGAAGCACACAAAAGTGGACTCGGCGATATCGAAGCTTTTTGAAGGCACAGTACGGTCTTTTGTGCAGTGTGTAAATG
TTGACTTTCAGTCGTTTCGTGACGAAAGTTTCTACGACTTGCAGCTAGACGTGAAAGGCTGTAAGGACTTGATGCAGTCTTTTCGTAAGTATGTGGAAGT
GGAAATGCTGGATGGTGACAATCAGTACGACGCTGAAGGACATGGGAAACAGGATGCCAAGAAGGGTATTGAGTTTGCCTCGTTTCCACCTGTCCTCAAT
ATCCAGCTTAAGCGCTTTGAGTACGATGCCATGCGTGATGGCATGGTCAAGGTTCATGATCGCTTCGAGTTTCCAAAAGTTCTTGTTCTCGATGAATTTA
TCGCTCACAGTAGCGCAACAAAAGACACCAACGAGAAATCTCCACGGTATGTTTATCATCTCCATAGCGTTCTGGTTCACAGTGGTGATGTGCACGGCGG
TCATTACTACGTATTTATTCGACCTGGAAAGCATACTAGTACAAGTACGAGTTGGTTCAAGTTTGACGATGACCAGATCACGCGCGTGGATGAACGTATA
GCAATCGAGGGAAATTATGGTTCTGCTGGGACTCCTGTAACACCACAAGGAGGATCTACGGAACCGCCGTCGCCTATGTGCTCGTCATCAATTTTTGGTC
CGTCTGATATGAATGATCAAAATGCTAATGAGCCGGGTGGCATAGATGGCTTAGAATTTTCGTCGGTGGTTGCACCAGGCGAGCCCGGTACTGGTGGTGG
CAGCGCAACGGATGAAGGATATGAGTACAGCCAATGTAATGACACAAGCAGTGTCCCGTTACGTCCTTCGTCAAGCACCCAGATGCTTCCACTTGGTAGG
AGTTTTTCTAGCGCATACATGCTTGTGTACGTGCGCAACGGTGAGAACGACATCAGCGCCATTCAGGAAGGGGCTTTTGTGAATACAGGGAGTATCACAA
CGACACCTTGTGCTTCAAAAGAGATTTCCGGGGCTGATCATTTACCCAACAACATTAAAACAGAAGTACCACCTATCAAACCGGAGATTCGTACTTGGGA
GAGCGATCCGGTGCCGATTCCGACCGAGCTGGTTACACGGTTCCACGAGGAGGAAAAAGCAGTTAGCCGGCGCAAGAAGGCTCAGCAGACAGAGCACTTG
TACACGAACCTTCGTATTGCCTCTGACACGAGCATCGCCAAACTGAGACGTATAACAAAGACGATGGACTTTTCCGGATTTAATAACTCGAACACGTTGC
GTATCCGCATTAAACGCACCGCATCGATCCGGCAGCTCTACCGTCGGGTGTGTAAAGAGACCGGCGTTCCCATGTTACGACAGCGCTTGTGGAAAGTCAT
TACGCGCGAAAATCGTACAACTCGACCTGATCAACCTCTCGGTCCCGATTTGTTTGACTGTCGTGTGGACTGGCTGATCGAGGATGATGCATCGCATAAA
GCCCCTGTTAAACTGTACCTTCAGATACTGAGTAGCGTGTTGGAATCTCCCGCATCGCCGTCATCCCCCTCCATCCATGCTCTTGAAGTAGAGGAATTGA
GTAGGATTGCAGCACCGGTCATCCATCGGCATTTCTGGGATGAATTTACACCTCCTGTACCAAACGAAAACAAATCGTTTGGTACAGGTGATACAACAGC
TAGCCAGGGGACGGAGGATGGTGATGAGGATGCGGCCACTGCATTTGCTGCGGCTGGTGAAAGCATCGTAGTCGACCACGCGCCGGCGCTGCAGAGTTAC
GAAATTGTGTTGTTCATCAAGTTTTACGACCCTAAGCGGAAACTTGGCGAGCGTTTGGAGTATGTAGGTAACGTAGTAGTGGATTCGCGGATAACTGGTG
CGGAGCTAGCGAAGTATCTACACGATGCACTATCAATTCCTATTATTGCGAAGTTACTGTTGTACGAGGAGGTCCAGCCGACCTCTGTGTCTGAGATTGA
CATGGAGTCAACACTAACGGGATCTGAAATTCAGAATGGTGATATAATTTGCTTCCAGTACGCAGAAAACGAAGACGTGTCGAACTGCGTTGTGATAAAT
CTAGGAATGGACGATGACCTTGGTGTGATGGGGACGACATATATCGGCCCTGATGGTGAAGAAATGAACAGTGTGACTTGTCCAGATAGTGACGATAATC
TGGTAGATACCAGTTCATTACCGAATTCGAGTGCCAGGTATAACAATGACAATCGGGGCCCTCATAGCCACGGGTTGGCTAAGGTAAGGCAGTCATGTGC
TGAAAAGCTTCACCAGCATCAGAGGCAGCTATCAGAGAGATATCCGGACGTGCCCTCATACTTCCAATACTTGCTAGATCGCGTGGAGGTGACTTTTCAT
CGGTATGGGCACTCGGAGGAAGAGTCCTTTACCCTTTCACTTTTGTTCAGTAACGTGTATGATGAGGTGATCGATGCTGTGGCGTCACACTTGGGACTTC
TTGGTCCAAAACGGTTGTTTGTACGATTGTACCAGCACTCACCTCTTAACAATTTGCCCATGAAGTCGCCGCTGCGTCATTCCCGATATGCTGGGGACGA
TCAAACTACATTGGAGGAGCTGCTTACTGAATATATGGAGCGCACCAATATTTTGTACTACGAGCTGCTGAGTTATCCTATTACAGAGATTGAAGCGAAG
AAGGAGCTACTCGTGCATCTCAGCATTTATGATGCTTGCTTTGCTACCGAAGAGGCAGCGTCGCCATCACCTGTTTCACCCCAGCGCCATATTGAAGTGC
TTGTCAAGCCCACGCATACGGTTCGCGACTTGCTCAAACTTATCCGGAAAGGGTGCCGGCTACCAGAGGACACACCGTTGCGTGCGTGCGAGACCGTCCA
GCACGGAACGATGATCACGCGTTTGATTCAGGAAGATGTGCCGCTGCAAAGCTACTGGGGTCAAGGTGCTGTGTCAGACCCCCATTCGCCTGAGATTTTG
GTGGAACAGATTCCTATGTACGAGATCAATAGCGACAACGGTATGGTGGACAAGCAGGCGTCCGCAATGTCAGAGCACAGGGTGTTCGGTGTCGCTAGTA
CAGAGGTGGTCACAGTAAAAGGAGACATATCACTGGAGAAGACCGAAGCTGCTCATGTACGATCACCGCGCCAGTTGAAGGATGTGTCGCCTGATGACGA
CGAAGCCCCAATGTGGTATTACAAGGGCGTGGTGCATTTCAACTTCCAGAACACCTCCCAAAAGTTGATACACCCGCATGGAGTGCCATGTGTCGTGCGT
TTTAGTGAGCGCGATACCGTCGGCGCCATCAAGGAGCGTATACGCCAGCGGTACGTTCCCTACTTTGACTTTTGCTGCCTGTTGTGCTACACGTGTGTAC
GTGCTCGAGTAACTAACTACCTTGTGTAGAATGGGTATCTCGTTTGAAGTCTTTGCACAGTGGAATTTTGCGCTCGTCAAGGACCTGAAAGCGTCAACGC
TGCAGAATGTGTACGACGAAATGGAGCCCGAGGCGCTCGACGCATTCCCCATGTCGCGGCTCACCGAGCTCTGCGGAGCCGACTTCGAACATTTAGGCAG
CTTAGGGCTGGAGCATGCGGACCCGACGCCGGTGCCTCGCCACCACAGCACCAGGAGACTGGAAACTGGTATTCACATTCGTCAGAGCTGAGCCGAGCCG
AATCATCAGACAAGCAAGACACGATATAGAGTGCAGGGCAGATCGAGTTGTTCTTGCTCTGCTGAGACGACGATTCGTGCCGTCGTTGGGCTCTGTGCCA
TTTGCCCAAGTTCCTCGTCTGACTTTGTATTGGCGGAAGACTTGATGGGTTTGCCAAATGCACCAACTTGAAGGAACCAGGCGACAAGAAGTGCCTCCCT
CACGTTGTTACTCTGCTGCCAGCACCACTGGCCC