Description :
From Genome Similarity Track
Location :
Scaffold_2241:1020- 2339
Sequence
1319 bases(100 bases per row)
CAGTTGTAGACCAATGGCGACGTGTCCCTGAACCATGCTTCCACGAAATTGATACGAGGAGACTCTCCTTGAGAAGTCAAGGGCCTGGTTGTTCTCCTGG
GTGTCACGACActcgtcggcgatgctgaCTTGGTAACGCTCAAGCTGGCTATGCGGACGCGCGGTACTcctggacgtggtggcgctgtacgtggtggcgc
tcgtgaaCTTGGCGGCGCCCTGCACTCAGCGCCTCTCCTGGACGTGACGGGGTAGACTTGGCGGCGCTTGCAGacttggcggcgctcgcggacacgacgg
cgctgtgGGCTTAGCGCCCCTCCTGGACACGTCGACGCTCCTGAACTTGACTCAGCGCCCCTCTTGAACACGTCAGTGCTCCTGAACTTGATTGTGTACC
CGGCCTTGGCGACGAAAGACGATAGGGGCTCACCTTCAACCACAACGCGATTTGGATCTATCGAATAAAGCACAATAAAACGAAGGTTGTATCTATTATT
GCAACGGTTTCTTGCTATAAAAGTAAAGTGGATGAAGAGACGCTTTCCACCTTCACCTCGTTCACTAACTCCCAGCGACTACAGAATTGTTCGGAGCATG
ATGAACGATGTATTGGGCAAAATACAGAGCTTGCAGCAATGATCCGGGCGCTTGGCAGCACACTGAGCTCACGTGAAACAACCAACTTTGCATCTTCTTC
AAAGAGAAAGATATTGGCGAATACAATAGTCGCATCGCGCATTGGTGGCTGGGATGAAATAGCTACGTCGCCAATGTCGGAGGCCTTGAGCAAGACCTCC
CTGAGTTGCGGGAGATCTTCAGCATGTCGGTCGATACAAACTTGTCCGAGTAAGCACAGCTCAGCACGAACCTCAATACCGACGCATAAACTGATATTTG
TGGTAAGGGCAACATGGGCAAGAATGTTGCCCACACCAGCACCTATATCGAGGAATATGTCGTTGTCATCTGCTGGACCGAGTGTCTCGATCATGGTGGA
GGCGCCTGACGGAAGTATCTCTCCTGCATTATCATGCATACGACCAGCTGATTGTCGAACGTCTGCCGCGTTGATTTCACCAAAAatcttgtgctgctgt
gtgaTGCGCAAGCAAATGATCTTCGGCCACTATCAACACCACCATCAACACTACCAGTCTTCATCCAATATCCAGAGTATCCACTGCCATGGACGCTGTA
CCGTTAGCAGTAACAACTGCTCCGGCGGCGGTCTCCTCTACGCCTTCACATGCTGTAATGACAcatcagcaacaacagcggTATGAGCAAAAATAGCTGT
ACCGGTAAGAGCAAACAGT