Description :
From Genome Similarity Track
Location :
Scaffold_679:1020- 2224
Transcript NameFunction/comments
Phyta_totarag10121conserved hypothetical protein

Sequence
1204 bases(100 bases per row)
CGCTCAGAACTCGCGCTGGCGACTGTTCATGGTGGCCGTCATGTTCCTGAGCCAAGtgttcgtggagctgggAAGGCGCGGCCTGCATTGTATGCAGCGC
AACGTGCCACACTACATTGCGTTCATGGACCGGTGGTTGGTGCAGTCGATCCGCGTGTCGGTGTACCCCAGTAAGAAGATGGGGACgttgcgtctgctgc
tggcgctggggTTGGCGTTCTCGCTGCCGTACATCGTGCTTACTATCGGGGGCATGCGTTTCCCTGTGGGGCGAGGGGTTAAAGTGAGGTGAGATGGCTG
TAAGTTCAACCGGAGAAACACGAACGTAATTTAAATTCGTAGAGTGTGGAGTATTGACGAATTTTTATGTAGTGCAGGcgagctggatgaagaaaaaATC
CGATCGCATATTATGGTGGACCGAGTGAATACGCCGGAACCGGGGCGTCGTCAGATGTTCCTTCGCGAAGGAGGCGACGGACTCAAGCTGGACGAAACAA
AGTCGAGGTGCGAGAATACTGTTCAGGGCGTGAGGCTGCTCACAGACTCGATGGGTAAGCGACGTATGCTTATACATTTACTGATGAAAGAGTTCATGTA
GTTACTGATGTTCATGTCAATGGTTTGGTGTAATGCTATTAGGTTATGTGTGTACACGATCTCAACTGGATAACGTGAAAcctggctgctgcaacgAGAC
CGATGCCAGCCTTCCGCGGATAAAGCAGTACACGTGCGACCGGTGCGATACGAACCCGCCGCACTGCTGCGACGCATTTGAGCACTGCGTGTCCTGCTGC
ATGCATCCACTCAATGTGGGTTCTGTGTTGCATCAACCATTTGCTGAGTCAGGTTTGAACTGACCTTGTTGAACTGTTTTTattgtgcttgtgcttgttg
tCAGTCGGGTATTCGCCGGCACTTCTTGACACACGCAGACCCAAACCACCCGGTCTACAGCGACCCGGCCGAGATCACTCTGTTCCAGTACTGTCAATAT
CGCTGCCGCACCTCGTCCgcgagcgtgcagcaccaaaactCGTACCGAAGGTGAGGCTCGCCAGCGTCAgctggacttcttggtcacATGAGTCTACAGT
ACTAACGTATAATTTCCGCTGCCATGTGCTGCGTCAGTCACCGCTCGTTCTGCTACGGCATCCATCGAccgctgaaggtgctgccgACCGTCAACAGCGA
TGGC