Description :
From Genome Similarity Track
Location :
Scaffold_791:102- 6050
Transcript NameFunction/comments
g16449.t1hypothetical protein
g16450.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569

Sequence
5948 bases(100 bases per row)
GCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGACTCTCTGTCGTCTCGAAGCGCGTCGCCGCGCTCGAGAGCG
CTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAATCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCC
AGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAACGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTA
GGTTCTGCGTAGCTAACAGAACTAATGAACCAATTTTAAATTCATTTGTGTTTCCCCTGCCGGTGTTGCCGGCGTTCAGCTTCTGTCGATCGACAGAAGC
TGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTC
GCAGTAGGCCCGGCCTGCGCGTGATGTCCGTTGTGGTTTAAAGTGTCTACGCCCGTCGTAGACACTGCGTTGTCGACGCCATGACTGCGCGCAGTACGTG
CGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCACTTAAGGAAGGAGCTACCGCA
CCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCA
TCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCATAGCTCTTCATGGTGTCAACCAACACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGG
GTGATCCGCAGTCGACATGGACAACTGCGTTCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCTGATCCGACACGATGCCG
AGTGGCATACCATGGTGTCTAAACACCAGGTCAACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGC
TGAAGCGGTCAACAAAGAGCACTATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGG
AGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGC
TGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCT
TCAGCTCATGATCATCCGGCACGACAATGCGAGCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGC
ACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAGGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGTGCGTATGCAGCCTTC
ACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACGCAGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCG
CGTCGGCCACGATATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGG
CGACTTGGTCGCCGTGCGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATG
GCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGTTTCAGCTGACGCGTTTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTT
GCATCAGTGCGCATTCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGAGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCC
CTGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGTTTCTTTCTTCAAGAGCTGCGAGAGCGGGCGAATCTTGCCCGCGTAG
TTGCTCACGTACTTGCACAAGTACGTGGCAAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCAATCTGGCCTTTC
CTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTTGCATAGAGCTTGTG
CTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACATCCCGGCTGTGAATGAACACGTCGTCGAAA
TAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCATTCTTCAGCCCTGCGGCATCACGAGCCACTC
CCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCAGTCTCTCAGATCCAGAGTACTGAAG
ATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGA
TGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGTTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAA
GTCGTTGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTG
TCCTGCGGTAACTCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGT
CGAAGCGTTCCTTCTTTGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTCCACACGTCATCCTCTCGACGTCCGA
GAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGTGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGA
GGATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGTGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGG
CAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTAGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTC
TTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGTTTGATTGCGCACCGCT
TCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACG
CGCCTCCTTTACCTCGACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGA
CCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGATCGGAGACA
GCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGTTGCTGCTGCTCC
CGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAG
GATGATAAGCTCGTCGATGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACACCGACACCCGTTGCTAGCCTCACT
TCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGATGCTCCACAGTCCACTAGAGCAC
GAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGGCTCTCACTGGGGGCAGCGAT
CTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGTGCGCCCCGCGCCTGCTGGTCCCTCTAGTTTTTTGTTAGCCCGTGACGAT
ACCAAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCTGCAGCGGAAACAACGCACATTCGT
TGATCCACGACGCTGCTGGGAACCAACAGCGATCGCCCTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGT
GGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGAT
AGGTCTTCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACGAAGTACCGTGC
TCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGTACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTG
AGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGG
CGAACGCAACCTTCGACAACGGGTCGACGATGCGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAAC
GTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCTTTCACGATGAAA
CCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCC
ACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTC
AGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAG
CTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCAACAAGTATACTTAAACCAAGATAAAAGAACC
AAACGAAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTATAATGAGAGGTTCTGCCATTGGATGGCT
GGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTTGCTATGAATGTGGACCACCCTGTGGTG
GTCACCTGAATGTGTGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG